Atlas of Genetics and Cytogenetics in Oncology and Haematology


Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA

MIR27A (microRNA 27a)

Written2012-05Yihui Ma, Jie Chen
PUMC Hospital, Chinese Academy of Medical Science, Peking Union Medical College, Beijing, 100730, China

(Note : for Links provided by Atlas : click)

Identity

Alias_namesMIRN27A
Alias_symbol (synonym)hsa-mir-27a
Other aliasMIR27
miR-27a
HGNC (Hugo) MIR27A
LocusID (NCBI) 407018
Atlas_Id 50398
Location 19p13.13  [Link to chromosome band 19p13]
Location_base_pair Starts at 13947254 and ends at 13947331 bp from pter ( according to hg19-Feb_2009)  [Mapping MIR27A.png]

DNA/RNA

 
  A) Genomic localization of miR-27a gene on chromosome 19p13.13; B) Stem-loop structure of miR-27a.
Description MiR-27 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-27 precursor is the microRNA, miR-27. Herpesvirus saimiri expresses several non-coding RNAs (HSURs) which have been found to significantly reduce the level of miR-27 in a host cell. It has been proposed that miR-27 operates together with miR-23 and miR-24 in a co-operative cluster. This miRNA was previously named miR-27 but is renamed here to avoid confusion with the more recently described miR-27b (MI0000440).
Transcription Mature miR-27a
The mature miRNA forms one strand of the RNA duplex. One strand is degraded and other is incorporated in to a protein complex, RNA induced silencing complex (RISC), targeting a partially complementary target mRNA. MiR-27a is 22 nucleotides long.
Sequence: 5' - uucacaguggcuaaguuccgc - 7'.
Pseudogene No reported pseudogenes.

Protein

Note miRNAs are not translated into amino acids.

Mutations

Note No mutations have been found in mature miR-27a sequence.

Implicated in

Note
  
Entity Breast cancer
Disease MiR-27a was first implicated in breast cancer as an oncomiRNA. Mertens-Talcott et al. found that miR-27a was highly expressed in breast cancer cells. They inhibited this microRNA using antisense molecules in MDA-MB-231 cells, and found that cell proliferation decreased with the decreasing of the percentage of cells in S phase and increasing of the percentage of cells in the G2-M phase by regulating the potential targets Myt-1 and the Sp repressor ZBTB10. Li et al. found that both as-miR-27a and overexpression of ZBTB10 decreased Sp1, Sp3, and Sp4 mRNA and protein expression in E2-responsive MCF-7 cells, and this was also accompanied by decreased levels of estrogen receptor alpha (ERalpha) mRNA and protein. BA-dependent repression of Sp1, Sp3, Sp4 and Sp-regulated genes was partly due to induction of the Sp repressor ZBTB10 and downregulation of miR-27a, which identified a new cellular target for this anticancer agent. Recently, Liu et al. found that suppression of miR-27a together with miR-96 and miR-182 resulted in an increase in FOXO1 protein, which decreased the cell numbers of breast cancer through inhibition of cell cycle traverse and increased cell death.
The single nucleotide polymorphisms (SNPs) in miR-27a also played a role in the breast cancer. The G-variant of rs895819, which located in the terminal loop of pre-miRNA-27a, might impair the maturation of the oncogenic miR-27a and is associated with familial breast cancer risk.
  
  
Entity Gastric cancer
Disease MiR-27a was up-regulated in human gastric adenocarcinoma. Suppression of miR-27a inhibited gastric cancer cell growth by targeting prohibitin. Subsequently, it has been reported that down-regulation of miR-27a could also confer sensitivity of drugs on gastric cancer cells, and might increase accumulation and decrease releasing amount of adriamycin in gastric cancer cells. Down-regulation of miR-27a could significantly decrease the expression of P-glycoprotein and the transcriptional activity of cyclin D1, and up-regulate the expression of p21. In Japanese male subjects, the miR-27a polymorphism was associated with the gastric mucosal atrophy and metaplasia, and the miR-27a genome region polymorphism may be an important definitive factor to develop the gastric mucosal atrophy. The same to the breast cancer, a common polymorphism (rs895819) in hsa-mir-27a, by modulating miR-27a and ZBTB10 levels, also acted as an important factor of the gastric cancer susceptibility.
  
  
Entity Pancreatic cancer
Disease Using the technique of microRNA arrays or real time PCR, studies have shown the deregulation of miR-27a in pancreatic cancer tissues. Further study showed that down-regulation of miR-27a suppressed the growth, colony formation and migration of these two cell lines by targeting Spry2, which played a role as an antagonist of Ras/MAPK signaling pathway in several malignancies.
  
  
Entity Prostate cancer
Disease MiR-27a was an androgen-regulated oncomiRNA in prostate cancer, acting via targeting the tumour suppressor and AR corepressor, Prohibitin (PHB). Androgens, therefore regulated miR-27a expression both transcriptionally (via AR binding to the cluster promoter) and post-transcriptionally (accelerating primiR processing to the mature form). Moreover, it has been shown that a miR-27a anti-sense oligonucleotide, by opposing the effects of mir-27a, has therapeutic potential in prostate cancer.
Upregulation of miR-23a, miR-27a, miR-24-2 cluster induces caspase-dependent and -independent apoptosis in human embryonic kidney cells. Bioinformatically, FADD, one of genes involved in apoptosis, is predicted to be the direct target of hsa-miR-27a.
  
  
Entity Various cancer
Note Therapy resistance: In colon cancer cells, CDODA-Me acted through downregulation of miR-27a which is accompanied by enhanced expression of ZBTB10 and Myt-1.
In leukaemia cell lines, the expression of miR-27a was inversely correlated with the expression of P-glycoprotein (P-gp), a drug-resistant factor. Transfection of the K562 and HL60 DOX-resistant cells (a human promyelocytic cell line, HL) with miR-27a resulted in the increased sensitivity of cells to DOX.
Down-regulation of miR-27a could also confer sensitivity of both P-glycoprotein-related and P-glycoprotein-non-related drugs on esophageal cancer cells with the decreasing of Bcl-2 and the transcription of the multidrug resistance gene 1, but the increasing expression of Bax.
The expression levels of miR-27a and P-gp were up-regulated in paclitaxel-resistant ovarian cancer cell line A2780/Taxol as compared with its parental line A2780. Transfection of A2780/Taxol cells with miR-27a inhibitor decreased the expression of MDR1 mRNA and P-gp protein, increased HIPK2 protein expression, enhanced the sensitivity of A2780/taxol cells to paclitaxel.

Differenciation: MiR-27a was demonstrated to modulate β-MHC gene regulation via thyroid hormone signaling and to be upregulated during the differentiation of mouse embryonic stem (ES) cells or in hypertrophic hearts in association with β-MHC gene upregulation.
MiR-27a played a regulatory role in megakaryocytic differentiation by attenuating Runx1 expression, which is an important cell lineage-specific regulator of hematopoiesis. Moreover, Runx1 and miR-27a were engaged in a feedback loop involving positive regulation of miR-27a expression by Runx1.

Cell division: MiR-27a was also reported as a novel factor fine-tuning the periodic events regulating cell cycle progression by regulation of FBW7.
MiR-27a was identified as a key regulator of p44 mRNA. Moreover, miR-27a was shown to destabilize the p44 subunit of the TFIIH complex during the G2-M phase, thereby modulating the transcriptional shutdown observed during this transition.

Oncogenesis MiR-27a was upregulated in SV40 ST-transformed human bronchial epithelial cells (HBERST). Suppression of miR-27a expression in HBERST cells or lung cancer cell lines (NCI-H226 and SK-MES-1) that exhibited high levels of miR-27a expression led to cell growth arrested in the G(0)-G(1) phase by suppression of Fbxw7, the possible target of miR-27a.
  

Bibliography

A polymorphism of microRNA 27a genome region is associated with the development of gastric mucosal atrophy in Japanese male subjects.
Arisawa T, Tahara T, Shibata T, Nagasaka M, Nakamura M, Kamiya Y, Fujita H, Hasegawa S, Takagi T, Wang FY, Hirata I, Nakano H.
Dig Dis Sci. 2007 Jul;52(7):1691-7. Epub 2007 Mar 16.
PMID 17546506
 
A regulatory interplay between miR-27a and Runx1 during megakaryopoiesis.
Ben-Ami O, Pencovich N, Lotem J, Levanon D, Groner Y.
Proc Natl Acad Sci U S A. 2009 Jan 6;106(1):238-43. Epub 2008 Dec 29.
PMID 19114653
 
Upregulation of miR-23a-27a-24-2 cluster induces caspase-dependent and -independent apoptosis in human embryonic kidney cells.
Chhabra R, Adlakha YK, Hariharan M, Scaria V, Saini N.
PLoS One. 2009 Jun 9;4(6):e5848.
PMID 19513126
 
Down-regulated miR-331-5p and miR-27a are associated with chemotherapy resistance and relapse in leukaemia.
Feng DD, Zhang H, Zhang P, Zheng YS, Zhang XJ, Han BW, Luo XQ, Xu L, Zhou H, Qu LH, Chen YQ.
J Cell Mol Med. 2011 Oct;15(10):2164-75. doi: 10.1111/j.1582-4934.2010.01213.x.
PMID 21070600
 
Androgen-regulated processing of the oncomir MiR-27a, which targets Prohibitin in prostate cancer.
Fletcher CE, Dart DA, Sita-Lumsden A, Cheng H, Rennie PS, Bevan CL.
Hum Mol Genet. 2012 Apr 18. [Epub ahead of print]
PMID 22505583
 
Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells.
Guttilla IK, White BA.
J Biol Chem. 2009 Aug 28;284(35):23204-16. Epub 2009 Jul 1.
PMID 19574223
 
MiRNA-27a controls FBW7/hCDC4-dependent cyclin E degradation and cell cycle progression.
Lerner M, Lundgren J, Akhoondi S, Jahn A, Ng HF, Moqadam FA, Oude Vrielink JA, Agami R, Den Boer ML, Grander D, Sangfelt O.
Cell Cycle. 2011 Jul 1;10(13):2172-83. Epub 2011 Jul 1.
PMID 21597324
 
MicroRNA-27a Indirectly Regulates Estrogen Receptor {alpha} Expression and Hormone Responsiveness in MCF-7 Breast Cancer Cells.
Li X, Mertens-Talcott SU, Zhang S, Kim K, Ball J, Safe S.
Endocrinology. 2010 Jun;151(6):2462-73. Epub 2010 Apr 9.
PMID 20382698
 
[Expression of microRNA 27a and its correlation with drug resistance in human ovarian cancer A2780/Taxol cells].
Li ZM, Hu S, Xiao L, Wang J, Cai J, Yu LL, Wang ZH.
Zhonghua Fu Chan Ke Za Zhi. 2010 May;45(5):372-5.
PMID 20646448
 
MicroRNA-27a functions as an oncogene in gastric adenocarcinoma by targeting prohibitin.
Liu T, Tang H, Lang Y, Liu M, Li X.
Cancer Lett. 2009 Jan 18;273(2):233-42. Epub 2008 Sep 13.
PMID 18789835
 
Betulinic Acid Targets YY1 and ErbB2 through Cannabinoid Receptor-dependent Disruption of MicroRNA-27a:ZBTB10 in Breast Cancer.
Liu X, Jutooru I, Lei P, Kim K, Lee SO, Brents LK, Prather PL, Safe SH.
Mol Cancer Ther. 2012 May 2. [Epub ahead of print]
PMID 22553354
 
miR-27a regulates the growth, colony formation and migration of pancreatic cancer cells by targeting Sprouty2.
Ma Y, Yu S, Zhao W, Lu Z, Chen J.
Cancer Lett. 2010 Dec 8;298(2):150-8. Epub 2010 Jul 17.
PMID 20638779
 
The oncogenic microRNA-27a targets genes that regulate specificity protein transcription factors and the G2-M checkpoint in MDA-MB-231 breast cancer cells.
Mertens-Talcott SU, Chintharlapalli S, Li X, Safe S.
Cancer Res. 2007 Nov 15;67(22):11001-11.
PMID 18006846
 
MicroRNA-27a regulates beta cardiac myosin heavy chain gene expression by targeting thyroid hormone receptor beta1 in neonatal rat ventricular myocytes.
Nishi H, Ono K, Horie T, Nagao K, Kinoshita M, Kuwabara Y, Watanabe S, Takaya T, Tamaki Y, Takanabe-Mori R, Wada H, Hasegawa K, Iwanaga Y, Kawamura T, Kita T, Kimura T.
Mol Cell Biol. 2011 Feb;31(4):744-55. Epub 2010 Dec 13.
PMID 21149577
 
MicroRNA-27a regulates basal transcription by targeting the p44 subunit of general transcription factor IIH.
Portal MM.
Proc Natl Acad Sci U S A. 2011 May 24;108(21):8686-91. Epub 2011 May 10.
PMID 21558443
 
Rapid alteration of microRNA levels by histone deacetylase inhibition.
Scott GK, Mattie MD, Berger CE, Benz SC, Benz CC.
Cancer Res. 2006 Feb 1;66(3):1277-81.
PMID 16452179
 
Hsa-mir-27a genetic variant contributes to gastric cancer susceptibility through affecting miR-27a and target gene expression.
Sun Q, Gu H, Zeng Y, Xia Y, Wang Y, Jing Y, Yang L, Wang B.
Cancer Sci. 2010 Oct;101(10):2241-7. doi: 10.1111/j.1349-7006.2010.01667.x. Epub 2010 Jul 27.
PMID 20666778
 
Upregulation of miR-27a contributes to the malignant transformation of human bronchial epithelial cells induced by SV40 small T antigen.
Wang Q, Li DC, Li ZF, Liu CX, Xiao YM, Zhang B, Li XD, Zhao J, Chen LP, Xing XM, Tang SF, Lin YC, Lai YD, Yang P, Zeng JL, Xiao Q, Zeng XW, Lin ZN, Zhuang ZX, Zhuang SM, Chen W.
Oncogene. 2011 Sep 8;30(36):3875-86. doi: 10.1038/onc.2011.103. Epub 2011 Apr 4.
PMID 21460851
 
A genetic variant in the pre-miR-27a oncogene is associated with a reduced familial breast cancer risk.
Yang R, Schlehe B, Hemminki K, Sutter C, Bugert P, Wappenschmidt B, Volkmann J, Varon R, Weber BH, Niederacher D, Arnold N, Meindl A, Bartram CR, Schmutzler RK, Burwinkel B.
Breast Cancer Res Treat. 2010 Jun;121(3):693-702. Epub 2009 Nov 18.
PMID 19921425
 
Down-regulation of miR-27a might reverse multidrug resistance of esophageal squamous cell carcinoma.
Zhang H, Li M, Han Y, Hong L, Gong T, Sun L, Zheng X.
Dig Dis Sci. 2010 Sep;55(9):2545-51. Epub 2009 Dec 4.
PMID 19960259
 
Down-regulation of miR-27a might inhibit proliferation and drug resistance of gastric cancer cells.
Zhao X, Yang L, Hu J.
J Exp Clin Cancer Res. 2011 May 13;30:55.
PMID 21569481
 

Citation

This paper should be referenced as such :
Ma, Y ; Chen, J
MIR27A (microRNA 27a)
Atlas Genet Cytogenet Oncol Haematol. 2012;16(11):813-816.
Free journal version : [ pdf ]   [ DOI ]
On line version : http://AtlasGeneticsOncology.org/Genes/MIR27AID50398ch19p13.html


External links

Nomenclature
HGNC (Hugo)MIR27A   31613
Cards
AtlasMIR27AID50398ch19p13
Entrez_Gene (NCBI)MIR27A  407018  microRNA 27a
AliasesMIR27; MIRN27A; mir-27a
GeneCards (Weizmann)MIR27A
Ensembl hg19 (Hinxton)ENSG00000207808 [Gene_View]  chr19:13947254-13947331 [Contig_View]  MIR27A [Vega]
Ensembl hg38 (Hinxton)ENSG00000207808 [Gene_View]  chr19:13947254-13947331 [Contig_View]  MIR27A [Vega]
ICGC DataPortalENSG00000207808
TCGA cBioPortalMIR27A
AceView (NCBI)MIR27A
Genatlas (Paris)MIR27A
WikiGenes407018
SOURCE (Princeton)MIR27A
Genetics Home Reference (NIH)MIR27A
miRBaseMIR27A
dbDEMCMIR27A
Genomic and cartography
GoldenPath hg19 (UCSC)MIR27A  -     chr19:13947254-13947331 -  19p13.13   [Description]    (hg19-Feb_2009)
GoldenPath hg38 (UCSC)MIR27A  -     19p13.13   [Description]    (hg38-Dec_2013)
EnsemblMIR27A - 19p13.13 [CytoView hg19]  MIR27A - 19p13.13 [CytoView hg38]
Mapping of homologs : NCBIMIR27A [Mapview hg19]  MIR27A [Mapview hg38]
OMIM612153   
Gene and transcription
Genbank (Entrez)AF480561 AJ421749 LM608174
RefSeq transcript (Entrez)
RefSeq genomic (Entrez)NC_000019 NC_018930 NT_011295 NW_004929414
Consensus coding sequences : CCDS (NCBI)MIR27A
Alternative Splicing GalleryENSG00000207808
Gene ExpressionMIR27A [ NCBI-GEO ]   MIR27A [ EBI - ARRAY_EXPRESS ]   MIR27A [ SEEK ]   MIR27A [ MEM ]
Gene Expression Viewer (FireBrowse)MIR27A [ Firebrowse - Broad ]
SOURCE (Princeton)Expression in : [Datasets]   [Normal Tissue Atlas]  [carcinoma Classsification]  [NCI60]
BioGPS (Tissue expression)407018
GTEX Portal (Tissue expression)MIR27A
Protein : pattern, domain, 3D structure
Domain families : Pfam (Sanger)
Domain families : Pfam (NCBI)
Conserved Domain (NCBI)MIR27A
DMDM Disease mutations407018
Blocks (Seattle)MIR27A
Human Protein AtlasENSG00000207808
Protein Interaction databases
FunCoupENSG00000207808
BioGRIDMIR27A
STRING (EMBL)MIR27A
ZODIACMIR27A
Ontologies - Pathways
Huge Navigator MIR27A [HugePedia]
snp3D : Map Gene to Disease407018
BioCentury BCIQMIR27A
ClinGenMIR27A
Clinical trials, drugs, therapy
Chemical/Protein Interactions : CTD407018
Chemical/Pharm GKB GenePA164722621
Clinical trialMIR27A
Miscellaneous
canSAR (ICR)MIR27A (select the gene name)
Probes
Litterature
PubMed119 Pubmed reference(s) in Entrez
GeneRIFsGene References Into Functions (Entrez)
CoreMineMIR27A
EVEXMIR27A
GoPubMedMIR27A
iHOPMIR27A
REVIEW articlesautomatic search in PubMed
Last year publicationsautomatic search in PubMed

Search in all EBI   NCBI

© Atlas of Genetics and Cytogenetics in Oncology and Haematology
indexed on : Tue Mar 14 13:44:40 CET 2017

Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

For comments and suggestions or contributions, please contact us

jlhuret@AtlasGeneticsOncology.org.