MIR122 (microRNA 122)
2013-11-01 Julie Gailius , Dayna Pinel , Joyce Wilson , Patricia Thibault AffiliationDepartment of Microbiology, Immunology, Vaccine, Infectious Disease Organization-Intervac (VIDO-Intervac), University of Saskatchewan, 107 Wiggins Rd, Saskatoon, SK S7N 5E5, Canada
Identity
HGNC
LOCATION
18q21.31
IMAGE
LEGEND
Figure1. Genomic context for chromosome 18 surrounding MIR122 (figure adapted from NCBI Gene).
LOCUSID
ALIAS
MIR122A,MIRN122,MIRN122A,hsa-mir-122,miRNA122,miRNA122A,mir-122
DNA/RNA
Note
miR-122 sequence:
Pre-miRNA sequence:
5-CCUUAGCAGAGCUGUGGAGUGUGACAAUGGUGUUUGUGUCUAAACUAUCAAACGCCAU
UAUCACACUAAAUAGCUACUGCUAGGC-3
Pre-miRNA sequence:
5-CCUUAGCAGAGCUGUGGAGUGUGACAAUGGUGUUUGUGUCUAAACUAUCAAACGCCAU
UAUCACACUAAAUAGCUACUGCUAGGC-3
Mature miR-122 sequences associated with this pre-miRNA sequence:
MIR 122-5P 15-UGGAGUGUGACAAUGGUGUUUG-36
MIR 122-3P 51-AACGCCAUUAUCACACUAAAUA-72
Primary isoforms of miR-122-5P:
UGGAGUGAGACAAUGGUGUUU
UGGAGUGAGACAAUGGUGUUUG
(Sequences from
Figure 2. Stem-loop structure of pre-miR-122. The pink highlighted regions indicate the mature miR-122 duplex; the top pink sequence is the hsa-miR-122-5P sequence and the bottom pink sequence is the hsa-miR-122-3P sequence (diagram adapted from miRBase).
Description
The coding sequence for microRNA-122 (miR-122) comprises a single locus on the human chromosome 18 (Jopling, 2012). After transcription and processing, miR-122 is loaded onto an RNA-Induced Silencing Complex (RISC), comprised of Argonaute 2 (Ago-2), GW182, and other proteins (Wilson and Huys, 2013), where the miRNA duplex is unwound and one strand, the "guide strand" is retained and the other strand, the "passenger strand", is discarded. The miRNA guide strand directs the RISC to target mRNAs based on imperfect sequence complementarity. Important base-pairing occurs between nucleotides 2 - 8 of the miRNA (the seed sequence) and the 3 un-translated region (UTR) of the target mRNA (Du and Zamore, 2005). RISC binding directs the repressed mRNA to a processing (P)-body, where the mRNA is sequestered and/or degraded (Wilson and Huys, 2013). miR-122 antagonism shows that miR-122 regulates, directly or indirectly, at least 199 liver mRNAs (Elmén et al., 2008).
Transcription
miRNA messenger RNAs are transcribed by RNA polymerase II, which generates a primary miRNA transcript (pri-miRNA) (Saj and Lai, 2011). Pri-miRNAs can encode a single miRNA, or multiple miRNAs expressed as a cluster (Arora et al., 2013). Unspliced pri-miR-122 is 7506 bp in length and only encodes miR-122; following splicing, the pri-miR-122 transcript is 4543 bp (Li et al., 2011). The spliced pri-miRNA contains a miR-122 stem-loop that is cleaved by a complex of Drosha, a nuclear RNase III enzyme, and DGCR8, a double-stranded RNA-binding protein to form the pre-miR-122 hairpin (Saj and Lai, 2011; Arora et al., 2013). The pre-miRNA is exported from the nucleus and cleaved once more in the cytoplasm by Dicer, an RNase III enzyme, resulting in the double-stranded miRNA duplex (figure 2) (Saj and Lai, 2011).
Studies have shown that expression of human miR-122 is highest in liver tissues, but is also detected in the nervous and respiratory systems (Landgraf et al., 2007). The same study showed that miR-122 is differentially expressed in cells of hematopoietic lineage (Landgraf et al., 2007). Regulation of miR-122 expression is not fully characterized, but involves liver enriched transcription factors (LETFs). LETF HNF4α binds to the miR-122 promoter region and positively regulates miR-122 expression in human hepatoma Huh-7 cells and in mouse liver (Li et al., 2011). Increased miR-122 results in activation of a number of transcriptional targets associated with , one of the key central regulators involved in miR-122 gene activation (Coulouarn et al., 2009). Other liver factors proposed to control miR-122 expression include HNF1A, HNF3A and HNF3B: a decrease in any of these factors results in reduced miR-122 expression; the same trend also occurs with HNF4G and HNF6 but to a lesser extent (Coulouarn et al., 2009). HNF6 is also part of a positive feedback loop that includes miR-122 and stimulates expression of various hepatocyte-specific genes and other LETFs required for hepatocyte differentiation (Laudadio et al., 2012). In addition, peroxisome proliferator activated receptor-gamma (PPARγ) and retinoid X receptor alpha (RXRα), can transcriptionally activate miR-122 (Song et al., 2013), but interestingly PPARγ inhibits miR-122 expression when bound by the hepatitis B virus X protein (Song et al., 2013). The variety of transcription factors that have direct or indirect roles on miR-122 expression allude to its multitude of functions.
Studies have shown that expression of human miR-122 is highest in liver tissues, but is also detected in the nervous and respiratory systems (Landgraf et al., 2007). The same study showed that miR-122 is differentially expressed in cells of hematopoietic lineage (Landgraf et al., 2007). Regulation of miR-122 expression is not fully characterized, but involves liver enriched transcription factors (LETFs). LETF HNF4α binds to the miR-122 promoter region and positively regulates miR-122 expression in human hepatoma Huh-7 cells and in mouse liver (Li et al., 2011). Increased miR-122 results in activation of a number of transcriptional targets associated with , one of the key central regulators involved in miR-122 gene activation (Coulouarn et al., 2009). Other liver factors proposed to control miR-122 expression include HNF1A, HNF3A and HNF3B: a decrease in any of these factors results in reduced miR-122 expression; the same trend also occurs with HNF4G and HNF6 but to a lesser extent (Coulouarn et al., 2009). HNF6 is also part of a positive feedback loop that includes miR-122 and stimulates expression of various hepatocyte-specific genes and other LETFs required for hepatocyte differentiation (Laudadio et al., 2012). In addition, peroxisome proliferator activated receptor-gamma (PPARγ) and retinoid X receptor alpha (RXRα), can transcriptionally activate miR-122 (Song et al., 2013), but interestingly PPARγ inhibits miR-122 expression when bound by the hepatitis B virus X protein (Song et al., 2013). The variety of transcription factors that have direct or indirect roles on miR-122 expression allude to its multitude of functions.
Proteins
Note
There is no protein associated with MIR 122.
Mutations
Figure 3. A. Location of SNPs near the mature miR-122 coding sequence. The highlighted region is the miR-122 sequence and the location of rs41292412 is indicated by the red line (diagram adapted from miRNASNP). B. Location of rs4129412 (green: C to T mutation in the chromosomal coding) in the miR-122 duplex (modified from miRBase).
Germinal
No.
Somatic
Yes.
Implicated in
Entity name
Hepatocellular carcinoma (HCC)
Note
miR-122 has been identified as a tumour-suppressor microRNA; loss of miR-122 expression has been observed in cases of hepatocellular carcinoma, and its function in suppressing tumour-like functions have been verified in animal and cell culture models (Bai et al., 2009; Coulouarn et al., 2009; Hsu et al., 2012; Kutay et al., 2006).
Prognosis
In miR-122 knockout mice, addition of exogenous miR-122 strongly suppressed tumourigenesis (Hsu et al., 2012). Restoration of miR-122 expression to hepatocellular carcinoma cells increased their sensitivity to chemotherapeutics adriamycin and vincristine; this was also marked by miR-122-mediated reduction of MDR-1, GST-π, MRP, Bcl-w, and Cyclin B1, aiding in induction of cell cycle arrest (Xu et al., 2011). Addition of miR-122 to HCC cells also rendered them more susceptible to doxorubicin treatment (Fornari et al., 2009). miR-122 is believed to aid many chemotherapeutic agents in hepatocellular carcinoma by downregulating the unfolded protein response, permitting therapeutic apoptosis that would otherwise be suppressed in cancer cells (Yang et al., 2011). The level of miR-122 in human serum is also being explored as a potential biomarker to detect hepatocellular carcinoma development and progression (Ding et al., 2012).
Oncogenesis
miR-122 is hypothesized to regulate terminal hepatocyte differentiation, and loss of its expression (with subsequent upregulation of stem cell-associated proteins such as Pkm2) is a potential step towards hepatocellular carcinoma development (Jung et al., 2011). Loss of expression in HCC tumour samples and cell lines resulted in acquisition of migration and invasive properties (Coulouarn et al., 2009; Tsai et al., 2009). Exogenous miR-122 was found to limit cell growth and promote apoptosis in hepatocellular carcinoma cell lines by suppressing Wnt1, which disrupts the canonical Wnt/β-catenin proliferation pathway (Xu et al., 2012). A subset of individuals with HCC have also been identified to bear a polymorphism (rs3783553) in the 3 UTR of IL-1α which is hypothesized to disrupt a miR-122 binding site. IL-1α is implicated in carcinogenesis and tumour growth, as well as immune responses to tumours, and miR-122 regulation of IL-1α under normal circumstances may be an aspect of its tumour suppressor function (Gao et al., 2009). miR-122 knockout mice are observed to develop hepatosteatosis, hepatitis, and hepatic tumours (Hsu et al., 2012). Increases in oncogenic pathways, along with inflammation and pro-inflammatory cytokine production such as IL-6 and TNF were also observed in the livers of these mice (Hsu et al., 2012).
Entity name
Cutaneous T-cell lymphoma (CTCL)
Oncogenesis
miR-122 is not normally expressed to high levels in T-cells, but has been identified in CTCL to be induced by p53 in response to chemotherapy, and reduce apoptosis of lymphomatous cells by stimulating Akt kinase with an unknown mechanism (Manfè et al., 2012). This is contrary to its normal pro-apoptotic (tumour suppressor) function in other cancers such as hepatocellular carcinoma.
Entity name
Gastrointestinal cancers
Note
Although miR-122 is not expressed in high levels within the intestinal tract, it was found to be downregulated in both primary tumours and gastrointestinal cancer cell lines, in comparison to normal tissues (Wang et al., 2009). In a rat model of colorectal cancer, this downregulation in healthy tissues was predictive of carcinogenesis elsewhere in the colon, and could be monitored from fecal colonocytes in the stool (Kunte et al., 2012).
Oncogenesis
It is implicated in partnering with the tumour suppressor gene APC (adenomatous polyposis coli), which degrades β-catenin and prevents proliferative signaling, as sequestration of miR-122 reversed APC-mediated growth inhibition, while addition of exogenous miR-122 restored growth inhibition in uncontrolled cells (Wang et al., 2009).
Entity name
Pancreatic adenocarcinoma
Note
miR-122 was found to be underexpressed in ductal pancreatic adenocarcinoma samples (Papaconstantinou et al., 2013).
Entity name
Breast cancer
Note
miR-122 was identified in serum deep sequencing of stage II-III breast cancer patients, with increased levels of miR-122 correlating with and later predicting non-responsiveness to neoadjuvant chemotherapy and metastatic outcomes (Wu et al., 2012).
Entity name
Tumour suppressor activity
Note
miR-122 has been implicated as a tumour suppressor in several different conditions, particularly hepatocellular carcinoma (Bai et al., 2009; Coulouarn et al., 2009; Hsu et al., 2012; Kutay et al., 2006). In hepatocellular carcinoma cell lines, it is believed to inhibit proliferation by suppressing Wnt/β-catenin signaling (Xu et al., 2012). miR-122 was determined to stabilize the tumour suppressor protein p53 by modulating Cyclin G1, with the added effect of enhancing hepatocellular carcinoma cells susceptibility to treatment with doxorubicin (Fornari et al., 2009). Its expression is also inversely correlated with levels of the protein Pkm2, found in hepatocellular carcinomas (Jung et al., 2011). A subset of individuals with HCC bear a polymorphism (rs3783553) in the 3 UTR of IL-1α which is hypothesized to disrupt a miR-122 binding site. IL-1α is implicated in carcinogenesis and tumour growth, as well as immune responses to tumours, and miR-122 regulation of IL-1α under normal circumstances may be an aspect of its tumour suppressor function (Gao et al., 2009). Loss of miR-122 expression led to increased cell migration and invasion, while restoration of miR-122 suppressed these effects (Coulouarn et al., 2009). miR-122 gene knockout mice are prone to hepatic tumour development, while delivery of miR-122 to these mice strongly inhibited tumourigenesis (Hsu et al., 2012).
In anaplastic thyroid cancer, miR-122 levels increase in thyroid cancer cell lines that respond to treatment with a PAX8/PPARγ fusion protein, both in vitro and in xenografts (Reddi et al., 2013).
In anaplastic thyroid cancer, miR-122 levels increase in thyroid cancer cell lines that respond to treatment with a PAX8/PPARγ fusion protein, both in vitro and in xenografts (Reddi et al., 2013).
Entity name
Lipid metabolism
Note
Microarrays have shown that miR-122 antagonism decreases the expression of several genes crucial to lipid metabolism, including ACC1, ACC2, ACLY, SCD1, and SREBP2, which contribute to fatty acid metabolism, and PMVK, which is essential for cholesterol biosynthesis (Esau et al., 2006). These mRNAs are not predicted to be direct targets of miR-122, so it is hypothesized that miR-122 may indirectly promote their expression by suppressing a transcriptional repressor (Esau et al., 2006). Consistent with these findings, miR-122 antagonism decreases serum cholesterol levels in chimpanzees (Lanford et al., 2010). Recently, Hsu et al. (2012) used miR-122 knock-out mice to identify AGPAT1 and CIDEC as direct targets of miR-122. CIDEC, also called FSP27, is associated with lipid droplets and regulates triglyceride storage and fatty acid oxidation at these sites (Keller et al., 2008; Vilà-Brau et al., 2013). In the liver, CIDEC is induced during the initial stages of fasting, but decreases during late fasting (Vilà-Brau et al., 2013). CIDEC is believed to be regulated by the PKA-CREB-CRTC2 pathway (Vilà-Brau et al., 2013), and the role of miR-122 in CIDEC regulation remains to be determined. AGPAT1 is involved in regulating the energy state in adipose and muscle tissues (Takeuchi and Reue, 2009). Overexpression studies show that AGPAT1 stimulates the conversion of fatty acids into triglycerides (Ruan and Pownall, 2001). Translational repression, mediated by miR-122 and the RISC, reduces the expression of CIDEC and AGPAT1 in hepatocytes (Hsu et al., 2012), and this inhibits the storage of triglycerides in liver tissue. miR-122 also directly targets cationic amino acid transporter 1 (CAT-1) mRNA (Chang et al., 2004), a membrane transporter expressed predominantly in peripheral tissues. In summary, research has demonstrated that miR-122 directly and indirectly regulates lipid metabolism in the liver, but the mechanism of indirect regulation is unknown.
Entity name
Liver damage
Note
Serum miR-122 has been identified as a potential biomarker for liver damage from many sources (Laterza et al., 2013). While some studies determine that serum miR-122 can be used to differentiate between different types of liver damage, especially when combined with other serum miRNAs, a comprehensive study has not yet been done to generate a diagnostic signature for the different causes of liver damage investigated. In both human and murine models of liver damage from alcohol and from Hepatitis B, miR-122 levels were elevated under damaged conditions, with levels correlating to disease scoring and severity (Zhang et al., 2010). In response to acute hepatotoxicity in humans, Ding et al. found miR-122 levels correlated with serum ALT levels, and further noted that when comparing HBV-associated liver damage to HCC-associated liver damage, the miR-122 profiles were distinct (Ding et al., 2012). miR-122 levels correlated with disease severity - although not viral titer - in chronically HCV-infected patients, and in patients with non-alcoholic fatty liver disease (Cermelli et al., 2011). In a rat model of liver transplantation, plasma miR-122 was evaluated as a marker of pending transplant rejection. In this instance, miR-122 expression was up-regulated upon liver damage (pre-transplantation), but did not signal transplant rejection (Hu et al., 2013). However, in human liver transplants, not only was miR-122 identified as a biomarker for liver damage, its expression was also significantly increased prior to and during acute transplant rejection (Farid et al., 2012). Starkey Lewis et al. demonstrated increased serum levels of miR-122 in patients experiencing acute acetaminophen poisoning, and observed that miR-122 levels were higher than with other forms of acute liver damage (Starkey Lewis et al., 2011). Finally, in a mouse model system, Bala et al. noted that the circulating form of miR-122, in combination with elevated or reduced levels, could be used to not only detect liver damage, but also to differentiate between causes: drug-induced injury led to miR-122 being found in the protein fraction of the mouse serum, while alcohol and inflammation-induced liver damage led to circulation of miR-122 in exosomes (Bala et al., 2012).
Entity name
Liver development
Note
Hepatocyte nuclear factor 6 (HNF6), a hepatocyte-specific transcription factor, promotes miR-122 expression in hepatocytes (Laudadio et al., 2012). miR-122, in turn, enhances the expression of HNF6 and other liver-enriched transcription factors (LETFs), establishing a positive-feedback loop (Laudadio et al., 2012). Along with other LETFs, HNF6 participates in a network of transcriptional regulation essential for the terminal differentiation of hepatocytes (Kyrmizi et al., 2006). miR-122 also downregulates CUTL1, a transcription factor that represses genes required for hepatocyte differentiation (Xu et al., 2010), thus promoting hepatocyte differentiation.
Entity name
Circadian rhythm
Note
Circadian expression of the miR-122 locus is under the control of two retinoid-related orphan receptor elements (ROREs) (Gatfield et al., 2009), on which REV-ERBα acts (Ueda et al., 2002). REV-ERBα is a transcription factor that plays key roles in the regulation of circadian transcriptional feedback loops (Reppert and Weaver, 2002). In the mouse liver, mature miR-122 levels remain relatively constant, but pre- and pri-miR-122 levels fluctuate over the course of the circadian cycle (Gatfield et al., 2009). The levels of these intermediates are lowest at Zeitgeber Time (ZT) 8-12 and highest at ZT24, and these periods correspond to the peak and minimal expression of REV-ERBα (Gatfield et al., 2009). Many miR-122 targets also demonstrate circadian fluctuations in expression that are concomitant with miR-122 fluctuation (Gatfield et al., 2009).
Entity name
Iron homeostasis
Note
miR-122 directly targets the hemochromatosis (Hfe) and hemojuvelin (Hjv) mRNAs for suppression (Castoldi et al., 2011). Hfe and Hjv activate hepcidin, a hormone that controls systemic iron levels (Nemeth et al., 2004). Hepcidin binds to and induces the degradation of ferroportin, an iron efflux channel expressed on cells able to release iron, including macrophages and hepatocytes (Castoldi and Muckenthaler, 2012). By suppressing the activators of hepcidin, miR-122 prevents hepcidin from interacting with ferroportin (Castoldi et al., 2011). This model is supported by the observation that miR-122 depletion leads to iron deficiency (Castoldi et al., 2011).
Entity name
Hepatitis C virus (HCV) infection
Note
HCV RNA bears two miR-122 binding sites in its 5 UTR (Jopling et al., 2008; Jopling et al., 2005). miR-122 binding has been shown to be critical to the viral life cycle by enhancing viral stability and translation, as well as other possible mechanisms that have yet to be determined, and has been proposed as the factor that defines the virus liver tropism (Henke et al., 2008; Sedano, 2012; Shimakami et al., 2012). This interaction requires the miRNA RISC protein Argonaute-2, but is otherwise non-canonical, as the miRNA binds both with its seed sequence and with other sequences to the 3 end of the miRNA (Machlin et al., 2011; Wilson et al., 2011). Along with the role it plays in the virus life cycle, miR-122 has been identified as a potential serum marker for HCV-induced liver damage and hepatocellular carcinoma (Bihrer et al., 2011; Cermelli et al., 2011; Ding et al., 2012; van der Meer et al., 2013).
Disease
Hepatitis C Virus is a blood-borne infection that frequently progresses to chronicity, and can lead to liver-associated diseases such as metabolic syndrome, steatosis, cirrhosis, decompensated liver disease and liver failure, and hepatocellular carcinoma. It can also have extra-hepatic manifestations such as cryoglobulinemia and other auto-immune disorders, or neurological symptoms such as depression and cognitive impairment (Maasoumy and Wedemeyer, 2012).
Prognosis
HCV infection can be cured in a growing number of patients, as new direct-acting antiviral therapies are developed. Current treatment involves a lengthy course of pegylated interferon-alpha injections and ribavirin; for patients infected with HCV genotype 1, the protease inhibitors Telaprevir or Boceprevir are included in the treatment. Host genetics and health status, along with viral genotype, strongly influence the potential effectiveness of treatment. Without treatment, infection can progress to the diseases above (Myers et al., 2012; Ramachandran et al., 2012).
Figure 4. Two molecules of miR-122 (blue) binding to the 5 UTR of the HCV RNA (black) with the seed sequence in bold. Binding outside of the seed sequence is shown by un-bolded pairing of miR-122 and viral RNA (Thibault et al., 2013).
Oncogenesis
A proportion of patients with a chronic hepatitis C virus infection progress to hepatocellular carcinoma, although the mechanisms of oncogenesis are not yet firmly identified. The virus proteins have been implicated in manipulating host cell signaling by downregulating, upregulating, or sequestering host factors (including the tumour-suppressor miR-122), leading to oncogenesis. Finally, as HCV is a chronic infection, the immunopathology from long-term low-grade inflammation can cause fibrosis, promoting cirrhosis and eventually carcinogenesis (Bühler and Bartenschlager, 2012).
Entity name
Hepatitis B virus (HBV) infection
Note
Loss of miR-122 in hepatitis B virus infection leads to increased viral replication; miR-122 was shown to suppress Cyclin G1 expression, which in turn releases the antiviral and anti-tumour protein p53 (Wang et al., 2012b). Conversely, addition of miR-122 was shown to inhibit HBV replication, and was proposed to limit HBV-associated hepatocellular carcinoma by suppressing NDRG3 (Fan et al., 2011). miR-122 has also been shown to directly bind to conserved HBV sequences, suppressing viral replication; in apparent response to this, the HBx viral protein inhibits miR-122 expression by binding PPARγ, a transcriptional activator of miR-122 (Chen et al., 2011; Song et al., 2013). In addition, HBV has been observed to overproduce the targeted transcript to act as a miR-122 sponge (Li et al., 2013). miR-122 has been proposed as a serum marker for HBV-associated liver damage and hepatocellular carcinoma, as a means of detecting active and occult HBV infections, and of predicting patient risk of HBV disease progression (Chen et al., 2012; Ding et al., 2012; Qi et al., 2011; Waidmann et al., 2012; Zhang et al., 2010).
Disease
Hepatitis B virus infection is a blood-borne infection that progresses to chronicity in about 5% of adult acute infections, although the risk is much higher in children and infants (Kuo and Gish, 2012). The most common and most severe complications from HBV infection are liver cirrhosis, hepatic decompensation, and hepatocellular carcinoma, although extrahepatic manifestations associated with immune complex-mediated injury are also fairly frequent (Liang, 2009; Nebbia et al., 2012). HBV-infected patients are also at risk from co-infection with a dependovirus, hepatitis D virus, which can only replicate in the presence of HBV, as it uses HBV proteins in its own infection cycle. HDV can exacerbate symptoms and progression of HBV infection (Farci and Niro, 2012).
Prognosis
HBV infections cannot be cured, but a functional cure can be effected in many patients through treatment with pegylated interferon and/or nucleo(t/s)ide analogues to suppress viral replication and eliminate circulating virus and antigens. Suppressing the virus in patients with an active infection reduces the risk of developing HBV-associated pathologies, including hepatocellular carcinoma (Kuo and Gish, 2012; Liaw, 2013). However, because the viral DNA is still present, since it integrates into the host genome, functionally cured patients experiencing immunosuppression are at risk of virus reactivation (Nebbia et al., 2012).
Oncogenesis
HBV does not have direct cytopathology associated with infection, and oncogenesis is instead attributed to chronic inflammation of the liver - causing fibrosis, cirrhosis, and eventually hepatocellular carcinoma - and the ability of the viral DNA to integrate randomly in the host chromosomes, resulting in loss of cellular regulation. The viral protein HBx manipulates cell cycle progression and host cell transcription patterns (including transcription of miR-122), and truncated mutants have been implicated in tumour production. Certain HBV mutants and HBV genotype C are also associated with higher risk of oncogenesis (Fallot et al., 2012).
Entity name
Up-regulated by alcohol consumption
Note
Alcohol consumption appears to up-regulate miR-122 expression, which in turn suppresses expression of Cyclin G1 (Hou et al., 2013). This may be mediated by production of HSP90, and its interaction with the protein GW182, which is involved in the microRNA silencing pathway (Bukong et al., 2013). In a rat model, miR-122 levels in the liver were significantly increased after chronic alcohol exposure (three weeks) (Dippold et al., 2013). This is believed to have a positive effect on hepatitis C Virus replication (Bukong et al., 2013; Hou et al., 2013).
Entity name
Non-alcoholic fatty liver disease (NAFLD) and steatohepatitis (NASH)
Note
miR-122 was downregulated in rats fed different diets that induce non-alcoholic fatty liver disease (Alisi et al., 2011). Mice fed with a high fat (NAFLD-inducing) diet, then treated with a miR-122 antagonist, demonstrated lowered serum cholesterol and some lipogenic genes were downregulated (Esau et al., 2006). Liver biopsies of patients with non-alcoholic steatohepatitis, on the severe end of the NAFLD spectrum, identified significantly lowered levels of miR-122 in these patients, in comparison to healthy control patients; this is suggested to dysregulate lipid metabolism and exacerbate the disease (Cheung et al., 2008). However, increased serum levels of miR-122 positively correlated with disease severity in NAFLD patients, although this may not be mechanistically associated with the disease (Cermelli et al., 2011).
Entity name
Hyperlipidaemia and coronary artery disease
Note
Blood plasma levels of miR-122 were elevated in patients with hyperlipidaemia; levels of miR-122 positively correlated with severity of coronary artery disease in patients, and also correlated with increased serum levels of total cholesterol, triglycerides, and low-density lipoprotein cholesterol in both control and diseased patients (Gao et al., 2012).
Entity name
Cardiac arrest
Note
miR-122 has been identified as a potential biomarker for neurological outcome after cardiac arrest. In a porcine model of cardiac arrest, high levels of plasma miR-122 were detected after induction of cardiac arrest (Andersson et al., 2012). Although miR-122 was not correlated with inflammation or cardiac damage, in a human study, increased serum levels of miR-122 were found in patients with poor neurological outcome (miR-122 is expressed at low levels in neurons) and were associated with elevated mortality (Stammet et al., 2012).
Entity name
Sepsis
Note
Reduced serum levels of miR-122 were identified in patients with sepsis, as compared to non-septic patients. However, the degree of reduction did not correlate with severity of sepsis (Wang et al., 2012a).
Entity name
Borna disease virus (BDV)
Note
Borna disease virus is a neurotropic virus that has been identified to contain miR-122 binding sites. Functional assays determined that miR-122 exerts a direct suppressive effect on viral replication and translation; it also appears to indirectly impact viral replication by enhancing interferon signaling (Qian et al., 2010).
Article Bibliography
| Pubmed ID | Last Year | Title | Authors |
|---|---|---|---|
| 20956972 | 2011 | Mirnome analysis reveals novel molecular determinants in the pathogenesis of diet-induced nonalcoholic fatty liver disease. | Alisi A et al |
| 22089187 | 2012 | Plasma levels of liver-specific miR-122 is massively increased in a porcine cardiogenic shock model and attenuated by hypothermia. | Andersson P et al |
| 23334784 | 2013 | miRNA-transcription factor interactions: a combinatorial regulation of gene expression. | Arora S et al |
| 19726678 | 2009 | MicroRNA-122 inhibits tumorigenic properties of hepatocellular carcinoma cells and sensitizes these cells to sorafenib. | Bai S et al |
| 22684891 | 2012 | Circulating microRNAs in exosomes indicate hepatocyte injury and inflammation in alcoholic, drug-induced, and inflammatory liver diseases. | Bala S et al |
| 21606975 | 2011 | Serum miR-122 as a biomarker of necroinflammation in patients with chronic hepatitis C virus infection. | Bihrer V et al |
| 23108300 | 2012 | Promotion of hepatocellular carcinoma by hepatitis C virus. | Bühler S et al |
| 22898980 | 2013 | Ethanol facilitates hepatitis C virus replication via up-regulation of GW182 and heat shock protein 90 in human hepatoma cells. | Bukong TN et al |
| 22678662 | 2012 | Regulation of iron homeostasis by microRNAs. | Castoldi M et al |
| 21886843 | 2011 | Circulating microRNAs in patients with chronic hepatitis C and non-alcoholic fatty liver disease. | Cermelli S et al |
| 17179747 | 2004 | miR-122, a mammalian liver-specific microRNA, is processed from hcr mRNA and may downregulate the high affinity cationic amino acid transporter CAT-1. | Chang J et al |
| 22392036 | 2012 | A pilot study of serum microRNA signatures as a novel biomarker for occult hepatitis B virus infection. | Chen Y et al |
| 21903935 | 2011 | A liver-specific microRNA binds to a highly conserved RNA sequence of hepatitis B virus and negatively regulates viral gene expression and replication. | Chen Y et al |
| 19030170 | 2008 | Nonalcoholic steatohepatitis is associated with altered hepatic MicroRNA expression. | Cheung O et al |
| 19617899 | 2009 | Loss of miR-122 expression in liver cancer correlates with suppression of the hepatic phenotype and gain of metastatic properties. | Coulouarn C et al |
| 22427142 | 2012 | Circulating microRNA-122 as a potential biomarker for liver injury. | Ding X et al |
| 22823254 | 2013 | Chronic ethanol feeding alters miRNA expression dynamics during liver regeneration. | Dippold RP et al |
| 16224044 | 2005 | microPrimer: the biogenesis and function of microRNA. | Du T et al |
| 18158304 | 2008 | Antagonism of microRNA-122 in mice by systemically administered LNA-antimiR leads to up-regulation of a large set of predicted target mRNAs in the liver. | Elmén J et al |
| 16459310 | 2006 | miR-122 regulation of lipid metabolism revealed by in vivo antisense targeting. | Esau C et al |
| 22722078 | 2012 | Diverse roles of hepatitis B virus in liver cancer. | Fallot G et al |
| 21725618 | 2011 | miR-122 inhibits viral replication and cell proliferation in hepatitis B virus-related hepatocellular carcinoma and targets NDRG3. | Fan CG et al |
| 22932971 | 2012 | Clinical features of hepatitis D. | Farci P et al |
| 21932376 | 2012 | Hepatocyte-derived microRNAs as serum biomarkers of hepatic injury and rejection after liver transplantation. | Farid WR et al |
| 19584283 | 2009 | MiR-122/cyclin G1 interaction modulates p53 activity and affects doxorubicin sensitivity of human hepatocarcinoma cells. | Fornari F et al |
| 22587332 | 2012 | Plasma levels of lipometabolism-related miR-122 and miR-370 are increased in patients with hyperlipidemia and associated with coronary artery disease. | Gao W et al |
| 19917630 | 2009 | An insertion/deletion polymorphism at miRNA-122-binding site in the interleukin-1alpha 3' untranslated region confers risk for hepatocellular carcinoma. | Gao Y et al |
| 19487572 | 2009 | Integration of microRNA miR-122 in hepatic circadian gene expression. | Gatfield D et al |
| 19020517 | 2008 | microRNA-122 stimulates translation of hepatitis C virus RNA. | Henke JI et al |
| 23126531 | 2013 | Alcohol facilitates HCV RNA replication via up-regulation of miR-122 expression and inhibition of cyclin G1 in human hepatoma cells. | Hou W et al |
| 22820288 | 2012 | Essential metabolic, anti-inflammatory, and anti-tumorigenic functions of miR-122 in liver. | Hsu SH et al |
| 23466638 | 2013 | Plasma microRNA, a potential biomarker for acute rejection after liver transplantation. | Hu J et al |
| 22258222 | 2012 | Liver-specific microRNA-122: Biogenesis and function. | Jopling C et al |
| 18621012 | 2008 | Position-dependent function for a tandem microRNA miR-122-binding site located in the hepatitis C virus RNA genome. | Jopling CL et al |
| 22140464 | 2011 | Epigenetic modulation of miR-122 facilitates human embryonic stem cell self-renewal and hepatocellular carcinoma proliferation. | Jung CJ et al |
| 18334488 | 2008 | Fat-specific protein 27 regulates storage of triacylglycerol. | Keller P et al |
| 23049818 | 2012 | Dysregulation of microRNAs in colonic field carcinogenesis: implications for screening. | Kunte DP et al |
| 22541703 | 2012 | Chronic hepatitis B infection. | Kuo A et al |
| 16924677 | 2006 | Downregulation of miR-122 in the rodent and human hepatocellular carcinomas. | Kutay H et al |
| 16912278 | 2006 | Plasticity and expanding complexity of the hepatic transcription factor network during liver development. | Kyrmizi I et al |
| 17604727 | 2007 | A mammalian microRNA expression atlas based on small RNA library sequencing. | Landgraf P et al |
| 19965718 | 2010 | Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection. | Lanford RE et al |
| 23547815 | 2013 | Circulating miR-122 as a potential biomarker of liver disease. | Laterza OF et al |
| 21920465 | 2012 | A feedback loop between the liver-enriched transcription factor network and miR-122 controls hepatocyte differentiation. | Laudadio I et al |
| 23221562 | 2013 | Hepatitis B virus mRNA-mediated miR-122 inhibition upregulates PTTG1-binding protein, which promotes hepatocellular carcinoma tumor growth and cell invasion. | Li C et al |
| 21241755 | 2011 | Positive regulation of hepatic miR-122 expression by HNF4α. | Li ZY et al |
| 19399811 | 2009 | Hepatitis B: the virus and disease. | Liang TJ et al |
| 23286854 | 2013 | Impact of therapy on the outcome of chronic hepatitis B. | Liaw YF et al |
| 23199500 | 2012 | Natural history of acute and chronic hepatitis C. | Maasoumy B et al |
| 21220300 | 2011 | Masking the 5' terminal nucleotides of the hepatitis C virus genome by an unconventional microRNA-target RNA complex. | Machlin ES et al |
| 22235305 | 2012 | miR-122 regulates p53/Akt signalling and the chemotherapy-induced apoptosis in cutaneous T-cell lymphoma. | Manfè V et al |
| 22720279 | 2012 | An update on the management of hepatitis C: consensus guidelines from the Canadian Association for the Study of the Liver. | Myers RP et al |
| 22252919 | 2012 | Hepatitis B infection: current concepts and future challenges. | Nebbia G et al |
| 15514116 | 2004 | Hepcidin regulates cellular iron efflux by binding to ferroportin and inducing its internalization. | Nemeth E et al |
| 22850622 | 2013 | Expression of microRNAs in patients with pancreatic cancer and its prognostic significance. | Papaconstantinou IG et al |
| 22174818 | 2011 | Serum microRNAs as biomarkers for hepatocellular carcinoma in Chinese patients with chronic hepatitis B virus infection. | Qi P et al |
| 20561966 | 2010 | Modulation of miR-122 on persistently Borna disease virus infected human oligodendroglial cells. | Qian J et al |
| 22296568 | 2012 | UK consensus guidelines for the use of the protease inhibitors boceprevir and telaprevir in genotype 1 chronic hepatitis C infected patients. | Ramachandran P et al |
| 23598436 | 2013 | Redifferentiation and induction of tumor suppressors miR-122 and miR-375 by the PAX8/PPARγ fusion protein inhibits anaplastic thyroid cancer: a novel therapeutic strategy. | Reddi HV et al |
| 12198538 | 2002 | Coordination of circadian timing in mammals. | Reppert SM et al |
| 11272131 | 2001 | Overexpression of 1-acyl-glycerol-3-phosphate acyltransferase-alpha enhances lipid storage in cellular models of adipose tissue and skeletal muscle. | Ruan H et al |
| 21592778 | 2011 | Control of microRNA biogenesis and transcription by cell signaling pathways. | Saj A et al |
| 22215596 | 2012 | Stabilization of hepatitis C virus RNA by an Ago2-miR-122 complex. | Shimakami T et al |
| 23703729 | 2013 | Epigenetic regulation of MicroRNA-122 by peroxisome proliferator activated receptor-gamma and hepatitis b virus X protein in hepatocellular carcinoma cells. | Song K et al |
| 22890253 | 2012 | Circulating microRNAs after cardiac arrest. | Stammet P et al |
| 22045675 | 2011 | Circulating microRNAs as potential markers of human drug-induced liver injury. | Starkey Lewis PJ et al |
| 19336658 | 2009 | Biochemistry, physiology, and genetics of GPAT, AGPAT, and lipin enzymes in triglyceride synthesis. | Takeuchi K et al |
| 23245472 | 2013 | MicroRNA-122-dependent and -independent replication of Hepatitis C Virus in Hep3B human hepatoma cells. | Thibault PA et al |
| 19296470 | 2009 | MicroRNA-122, a tumor suppressor microRNA that regulates intrahepatic metastasis of hepatocellular carcinoma. | Tsai WC et al |
| 12152080 | 2002 | A transcription factor response element for gene expression during circadian night. | Ueda HR et al |
| 23220584 | 2013 | Fsp27/CIDEC is a CREB target gene induced during early fasting in liver and regulated by FA oxidation rate. | Vilà-Brau A et al |
| 22239527 | 2012 | Serum microRNA-122 levels in different groups of patients with chronic hepatitis B virus infection. | Waidmann O et al |
| 23026916 | 2012 | Four serum microRNAs identified as diagnostic biomarkers of sepsis. | Wang HJ et al |
| 22105316 | 2012 | Loss of microRNA 122 expression in patients with hepatitis B enhances hepatitis B virus replication through cyclin G(1) -modulated P53 activity. | Wang S et al |
| 19607815 | 2009 | MicroRNA-122a functions as a novel tumor suppressor downstream of adenomatous polyposis coli in gastrointestinal cancers. | Wang X et al |
| 23881584 | 2013 | miR-122 promotion of the hepatitis C virus life cycle: sound in the silence. | Wilson JA et al |
| 21177824 | 2011 | Human Ago2 is required for efficient microRNA 122 regulation of hepatitis C virus RNA accumulation and translation. | Wilson JA et al |
| 22400902 | 2012 | De novo sequencing of circulating miRNAs identifies novel markers predicting clinical outcome of locally advanced breast cancer. | Wu X et al |
| 20842632 | 2010 | Liver-enriched transcription factors regulate microRNA-122 that targets CUTL1 during liver development. | Xu H et al |
| 22276989 | 2012 | MicroRNA-122 suppresses cell proliferation and induces cell apoptosis in hepatocellular carcinoma by directly targeting Wnt/β-catenin pathway. | Xu J et al |
| 21802841 | 2011 | MicroRNA-122 sensitizes HCC cancer cells to adriamycin and vincristine through modulating expression of MDR and inducing cell cycle arrest. | Xu Y et al |
| 21750653 | 2011 | Modulation of the unfolded protein response is the core of microRNA-122-involved sensitivity to chemotherapy in hepatocellular carcinoma. | Yang F et al |
| 20930130 | 2010 | Plasma microRNA-122 as a biomarker for viral-, alcohol-, and chemical-related hepatic diseases. | Zhang Y et al |
| 23383654 | 2013 | Sensitive detection of hepatocellular injury in chronic hepatitis C patients with circulating hepatocyte-derived microRNA-122. | van der Meer AJ et al |
Other Information
Locus ID:
NCBI: 406906
MIM: 609582
HGNC: 31501
Ensembl: ENSG00000284440
miRBase:
Variants:
dbSNP: 406906
ClinVar: 406906
TCGA: ENSG00000284440
COSMIC: MIR122
RNA/Proteins
Pathways
| Pathway | Source | External ID |
|---|---|---|
| MicroRNAs in cancer | KEGG | hsa05206 |
| MicroRNAs in cancer | KEGG | ko05206 |
References
| Pubmed ID | Year | Title | Citations |
|---|---|---|---|
| 37865291 | 2024 | miR-122 and miR-21 are Stable Components of miRNA Signatures of Early Lung Cancer after Validation in Three Independent Cohorts. | 2 |
| 37966142 | 2024 | MicroRNA-29a and microRNA-122 expressions and other inflammatory markers among obese children with diabetes. | 1 |
| 38243118 | 2024 | Circular RNA cVIM promotes hepatic stellate cell activation in liver fibrosis via miR-122-5p/miR-9-5p-mediated TGF-β signaling cascade. | 2 |
| 38365112 | 2024 | Exosomal miR-122-3p represses the growth and metastasis of MCF-7/ADR cells by targeting GRK4-mediated activation of the Wnt/β-catenin pathway. | 2 |
| 38503014 | 2024 | Ischemia and reperfusion-injured liver-derived exosomes elicit acute lung injury through miR-122-5p regulated alveolar macrophage polarization. | 1 |
| 38654205 | 2024 | CircPHGDH downregulation decreases papillary thyroid cancer progression through miR-122-5p/PKM2 axis. | 0 |
| 38956605 | 2024 | Dysregulated expression of miR-140 and miR-122 compromised microglial chemotaxis and led to reduced restriction of AD pathology. | 0 |
| 37865291 | 2024 | miR-122 and miR-21 are Stable Components of miRNA Signatures of Early Lung Cancer after Validation in Three Independent Cohorts. | 2 |
| 37966142 | 2024 | MicroRNA-29a and microRNA-122 expressions and other inflammatory markers among obese children with diabetes. | 1 |
| 38243118 | 2024 | Circular RNA cVIM promotes hepatic stellate cell activation in liver fibrosis via miR-122-5p/miR-9-5p-mediated TGF-β signaling cascade. | 2 |
| 38365112 | 2024 | Exosomal miR-122-3p represses the growth and metastasis of MCF-7/ADR cells by targeting GRK4-mediated activation of the Wnt/β-catenin pathway. | 2 |
| 38503014 | 2024 | Ischemia and reperfusion-injured liver-derived exosomes elicit acute lung injury through miR-122-5p regulated alveolar macrophage polarization. | 1 |
| 38654205 | 2024 | CircPHGDH downregulation decreases papillary thyroid cancer progression through miR-122-5p/PKM2 axis. | 0 |
| 38956605 | 2024 | Dysregulated expression of miR-140 and miR-122 compromised microglial chemotaxis and led to reduced restriction of AD pathology. | 0 |
| 36348252 | 2023 | FUT8 is regulated by miR-122-5p and promotes malignancies in intrahepatic cholangiocarcinoma via PI3K/AKT signaling. | 4 |
Citation
Julie Gailius ; Dayna Pinel ; Joyce Wilson ; Patricia Thibault
MIR122 (microRNA 122)
Atlas Genet Cytogenet Oncol Haematol. 2013-11-01
Online version: http://atlasgeneticsoncology.org/gene/44040/deep-insight-explorer/gene-explorer/
