MIR27A (microRNA 27a)
2012-05-01 Yihui Ma  , Jie Chen   AffiliationPUMC Hospital, Chinese Academy of Medical Science, Peking Union Medical College, Beijing, 100730, China
DNA/RNA

Description
Transcription
The mature miRNA forms one strand of the RNA duplex. One strand is degraded and other is incorporated in to a protein complex, RNA induced silencing complex (RISC), targeting a partially complementary target mRNA. MiR-27a is 22 nucleotides long.
Sequence: 5 - uucacaguggcuaaguuccgc - 7.
Pseudogene
Proteins
Note
Implicated in
The single nucleotide polymorphisms (SNPs) in miR-27a also played a role in the breast cancer. The G-variant of rs895819, which located in the terminal loop of pre-miRNA-27a, might impair the maturation of the oncogenic miR-27a and is associated with familial breast cancer risk.
Upregulation of miR-23a, miR-27a, miR-24-2 cluster induces caspase-dependent and -independent apoptosis in human embryonic kidney cells. Bioinformatically, FADD, one of genes involved in apoptosis, is predicted to be the direct target of hsa-miR-27a.
In leukaemia cell lines, the expression of miR-27a was inversely correlated with the expression of P-glycoprotein (P-gp), a drug-resistant factor. Transfection of the K562 and HL60 DOX-resistant cells (a human promyelocytic cell line, HL) with miR-27a resulted in the increased sensitivity of cells to DOX.
Down-regulation of miR-27a could also confer sensitivity of both P-glycoprotein-related and P-glycoprotein-non-related drugs on esophageal cancer cells with the decreasing of Bcl-2 and the transcription of the multidrug resistance gene 1, but the increasing expression of Bax.
The expression levels of miR-27a and P-gp were up-regulated in paclitaxel-resistant ovarian cancer cell line A2780/Taxol as compared with its parental line A2780. Transfection of A2780/Taxol cells with miR-27a inhibitor decreased the expression of MDR1 mRNA and P-gp protein, increased HIPK2 protein expression, enhanced the sensitivity of A2780/taxol cells to paclitaxel.
MiR-27a was identified as a key regulator of p44 mRNA. Moreover, miR-27a was shown to destabilize the p44 subunit of the TFIIH complex during the G2-M phase, thereby modulating the transcriptional shutdown observed during this transition. MiR-27a played a regulatory role in megakaryocytic differentiation by attenuating Runx1 expression, which is an important cell lineage-specific regulator of hematopoiesis. Moreover, Runx1 and miR-27a were engaged in a feedback loop involving positive regulation of miR-27a expression by Runx1.
Cell division: MiR-27a was also reported as a novel factor fine-tuning the periodic events regulating cell cycle progression by regulation of FBW7.
Article Bibliography
| Pubmed ID | Last Year | Title | Authors |
|---|---|---|---|
| 17546506 | 2007 | A polymorphism of microRNA 27a genome region is associated with the development of gastric mucosal atrophy in Japanese male subjects. | Arisawa T et al |
| 19114653 | 2009 | A regulatory interplay between miR-27a and Runx1 during megakaryopoiesis. | Ben-Ami O et al |
| 19513126 | 2009 | Upregulation of miR-23a-27a-24-2 cluster induces caspase-dependent and -independent apoptosis in human embryonic kidney cells. | Chhabra R et al |
| 21070600 | 2011 | Down-regulated miR-331-5p and miR-27a are associated with chemotherapy resistance and relapse in leukaemia. | Feng DD et al |
| 22505583 | 2012 | Androgen-regulated processing of the oncomir miR-27a, which targets Prohibitin in prostate cancer. | Fletcher CE et al |
| 19574223 | 2009 | Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells. | Guttilla IK et al |
| 21597324 | 2011 | MiRNA-27a controls FBW7/hCDC4-dependent cyclin E degradation and cell cycle progression. | Lerner M et al |
| 20382698 | 2010 | MicroRNA-27a Indirectly Regulates Estrogen Receptor {alpha} Expression and Hormone Responsiveness in MCF-7 Breast Cancer Cells. | Li X et al |
| 20646448 | 2010 | [Expression of microRNA 27a and its correlation with drug resistance in human ovarian cancer A2780/Taxol cells]. | Li ZM et al |
| 18789835 | 2009 | MicroRNA-27a functions as an oncogene in gastric adenocarcinoma by targeting prohibitin. | Liu T et al |
| 22553354 | 2012 | Betulinic acid targets YY1 and ErbB2 through cannabinoid receptor-dependent disruption of microRNA-27a:ZBTB10 in breast cancer. | Liu X et al |
| 20638779 | 2010 | miR-27a regulates the growth, colony formation and migration of pancreatic cancer cells by targeting Sprouty2. | Ma Y et al |
| 18006846 | 2007 | The oncogenic microRNA-27a targets genes that regulate specificity protein transcription factors and the G2-M checkpoint in MDA-MB-231 breast cancer cells. | Mertens-Talcott SU et al |
| 21149577 | 2011 | MicroRNA-27a regulates beta cardiac myosin heavy chain gene expression by targeting thyroid hormone receptor beta1 in neonatal rat ventricular myocytes. | Nishi H et al |
| 21558443 | 2011 | MicroRNA-27a regulates basal transcription by targeting the p44 subunit of general transcription factor IIH. | Portal MM et al |
| 16452179 | 2006 | Rapid alteration of microRNA levels by histone deacetylase inhibition. | Scott GK et al |
| 20666778 | 2010 | Hsa-mir-27a genetic variant contributes to gastric cancer susceptibility through affecting miR-27a and target gene expression. | Sun Q et al |
| 21460851 | 2011 | Upregulation of miR-27a contributes to the malignant transformation of human bronchial epithelial cells induced by SV40 small T antigen. | Wang Q et al |
| 19921425 | 2010 | A genetic variant in the pre-miR-27a oncogene is associated with a reduced familial breast cancer risk. | Yang R et al |
| 19960259 | 2010 | Down-regulation of miR-27a might reverse multidrug resistance of esophageal squamous cell carcinoma. | Zhang H et al |
| 21569481 | 2011 | Down-regulation of miR-27a might inhibit proliferation and drug resistance of gastric cancer cells. | Zhao X et al |
Other Information
Locus ID:
NCBI: 407018
MIM: 612153
HGNC: 31613
Ensembl: ENSG00000207808
miRBase:
Variants:
dbSNP: 407018
ClinVar: 407018
TCGA: ENSG00000207808
COSMIC: MIR27A
RNA/Proteins
Expression (GTEx)
Pathways
| Pathway | Source | External ID |
|---|---|---|
| MicroRNAs in cancer | KEGG | hsa05206 |
| MicroRNAs in cancer | KEGG | ko05206 |
PharmGKB
| Entity ID | Name | Type | Evidence | Association | PK | PD | PMIDs |
|---|---|---|---|---|---|---|---|
| PA128406956 | fluorouracil | Chemical | ClinicalAnnotation | associated | PK | PD | 24401318, 25655103, 25782327, 26804235 |
| PA130 | CYP3A4 | Gene | MultilinkAnnotation | associated | 26229046 | ||
| PA445062 | Neoplasms | Disease | ClinicalAnnotation | associated | PK | PD | 24401318, 25655103, 25782327, 26804235 |
| PA448771 | capecitabine | Chemical | ClinicalAnnotation | associated | PK | PD | 24401318, 25655103, 25782327, 26804235 |
References
| Pubmed ID | Year | Title | Citations |
|---|---|---|---|
| 38141416 | 2024 | MicroRNA miR-27a as a possible regulator of anti-inflammatory macrophage phenotype in preeclamptic placenta. | 0 |
| 38353109 | 2024 | MIR27A rs895819 TC genotype increases risk of fluoropyrimidine-induced severe toxicity independently of DPYD variations. | 0 |
| 38372101 | 2024 | MiR-27a-3p exacerbates cell migration and invasion in right-sided/left-sided colorectal cancer by targeting TGFBR2/TCF7L2. | 0 |
| 38412296 | 2024 | RNA-RNA interactions between respiratory syncytial virus and miR-26 and miR-27 are associated with regulation of cell cycle and antiviral immunity. | 0 |
| 38141416 | 2024 | MicroRNA miR-27a as a possible regulator of anti-inflammatory macrophage phenotype in preeclamptic placenta. | 0 |
| 38353109 | 2024 | MIR27A rs895819 TC genotype increases risk of fluoropyrimidine-induced severe toxicity independently of DPYD variations. | 0 |
| 38372101 | 2024 | MiR-27a-3p exacerbates cell migration and invasion in right-sided/left-sided colorectal cancer by targeting TGFBR2/TCF7L2. | 0 |
| 38412296 | 2024 | RNA-RNA interactions between respiratory syncytial virus and miR-26 and miR-27 are associated with regulation of cell cycle and antiviral immunity. | 0 |
| 35038059 | 2023 | METTL3 facilitates multiple myeloma tumorigenesis by enhancing YY1 stability and pri-microRNA-27 maturation in m(6)A-dependent manner. | 10 |
| 36848245 | 2023 | MicroRNA-27a-3p targets FoxO signalling to induce tumour-like phenotypes in bile duct cells. | 7 |
| 37019667 | 2023 | MicroRNA-27a, downregulated in human obesity, exerts an antiapoptotic function in adipocytes. | 3 |
| 37078000 | 2023 | MicroRNA-27a Suppresses the Toxic Action of Mepivacaine on Breast Cancer Cells via Inositol-Requiring Enzyme 1-TNF Receptor-Associated Factor 2. | 0 |
| 37113490 | 2023 | Association of miR-196a2 and miR-27a polymorphisms with gestational diabetes mellitus susceptibility in a Chinese population. | 2 |
| 37203408 | 2023 | miR‑27a‑3p upregulation by p65 facilitates cervical tumorigenesis by increasing TAB3 expression and is involved in the positive feedback loop of NF‑κB signaling. | 0 |
| 37246895 | 2023 | lncRNA RMST suppresses the progression of colorectal cancer by competitively binding to miR-27a-3p/RXRα axis and inactivating Wnt signaling pathway. | 1 |
Citation
Yihui Ma ; Jie Chen
MIR27A (microRNA 27a)
Atlas Genet Cytogenet Oncol Haematol. 2012-05-01
Online version: http://atlasgeneticsoncology.org/gene/50398/
