MIR143 (MicroRNA 143)
2014-02-01 Ava Kwong  , Vivian Y Shin  , John C W Ho   AffiliationDepartment of Surgery, The University of Hong Kong, Hong Kong, China
Identity
HGNC
LOCATION
5q32
IMAGE

LEGEND
Figure 1. Genes flanking hsa-miR-143 on chromosome 5q32. The red arrow indicates the position and orientation of miR-143.
LOCUSID
ALIAS
MIRN143,mir-143
FUSION GENES
DNA/RNA

Figure 2. The stem-loop structure of hsa-miR-143, with sequences of mature miR-143-5p and miR-143-3p highlighted in red.
Description
hsa-miR-143 is clustered with miR-145, which are separated by approximately 1.6 kb, and are located within an intergenic region on chromosome 5 (5q32). Positions of the clustered miRNAs are:
- hsa-mir-143: chr5: 148808481-148808586 [+]
- hsa-mir-145: chr5: 148810209-148810296 [+].
- hsa-mir-143: chr5: 148808481-148808586 [+]
- hsa-mir-145: chr5: 148810209-148810296 [+].
Transcription
The miR-143/145 cluster was demonstrated to be transcribed from a non-protein coding host gene (MIR143HG; GenBank: NR_027180) into an 11 kb primary miRNA transcript (pri-miRNA), which was then processed into the mature microRNAs (Iio et al., 2010). Expression of the cluster host gene and mature miR-143 were found to be reduced in various human cancer tissues and cell lines (Iio et al., 2010). DEAD-box RNA helicase 6 (DDX6) was reported to post-transcriptionally down-regulate miR-143/145 levels by increasing the instability of MIR143 host gene RNA product (Iio et al., 2013). Moreover, tumour suppressor protein p53 was reported to enhance the miR-143 maturation in a transcription-independent manner (Suzuki et al., 2009).
Pre-mir-143:
- Accession no.: MI0000459
- Length: 106 nt
- Sequence: GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC
Mature hsa-miR-143-5p:
- Accession no.: MIMAT0004599
- Length: 22 nt
- Sequence: 27- GGUGCAGUGCUGCAUCUCUGGU -48
Mature hsa-miR-143-3p:
- Accession no.: MIMAT0000435
- Length: 21 nt
- Sequence: 61- UGAGAUGAAGCACUGUAGCUC -81
Pre-mir-143:
- Accession no.: MI0000459
- Length: 106 nt
- Sequence: GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC
Mature hsa-miR-143-5p:
- Accession no.: MIMAT0004599
- Length: 22 nt
- Sequence: 27- GGUGCAGUGCUGCAUCUCUGGU -48
Mature hsa-miR-143-3p:
- Accession no.: MIMAT0000435
- Length: 21 nt
- Sequence: 61- UGAGAUGAAGCACUGUAGCUC -81
Pseudogene
No pseudogenes were reported for miR-143.
Proteins
Note
miRNAs are not translated into amino acids.
Implicated in
Entity name
Non-small cell lung cancer
Note
miR-143 has been found to be down-regulated in non-small cell lung cancer (NSCLC) tissues and was negatively correlated with PKCε expression. It was shown to regulate PKCε expression and was associated with apoptosis in NSCLC cells (Zhang et al., 2013b).
Entity name
Colorectal cancer
Note
miR-143 level was found to be down-regulated in colorectal cancer patients blood and tumour tissues. Over-expression of miR-143 inhibited tumour growth and angiogenesis, and increased the chemosensitivity to oxaliplatin treatment (Qian et al., 2013). miR-143 was also reported to reduce the invasion and migration of colorectal carcinoma cells by targeting the Toll-like receptor 2 (TLR2) signalling pathway (Guo et al., 2013).
Entity name
Pancreatic cancer
Note
miR-143 was reported to modulate the prostaglandin E2 (PGE2) production and PGE2-mediated cellular proliferation, in pancreatic cancer cells, by targeting the COX-2 mRNA stability and expression (Pham et al., 2013).
Entity name
Esophageal squamous cell carcinoma
Note
miR-143 expression was reduced in esophageal squamous cell carcinoma (ESCC) tissues as compared with the adjacent normal tissues. Restoration of the miR-143 expression was demonstrated to induce ESCC cells apoptosis and suppress the cell migration and invasion (Ni et al., 2013).
Entity name
Prostate cancer cells
Note
miR-143 and miR-145 were reported to inhibit the cell viability and tumorigenicity of the bone metastatic prostate cancer cells, PC-3. They were suggested to play an important role in the bone metastasis of prostate cancer by regulating the cancer stem cell characteristics (Huang et al., 2012).
Entity name
Cervical cancer
Note
miR-143 level was deregulated in cervical cancer tissues, as demonstrated by miRNA microarray (Liu et al., 2012). Over-expression of miR-143 in HeLa cells was reported to promote apoptosis and suppress xenograft tumour formation, by targeting the Bcl-2 gene.
Entity name
Bladder cancer cells
Note
miR-143 and miR-145 co-treatment on bladder cancer cell lines, T24 and NKB1, was showed to synergistically inhibit cell growth by suppressing the PI3K/Akt and MAPK signalling pathways (Noguchi et al., 2013).
Entity name
Liposarcoma
Note
miR-143 expression was found to be reduced in both well-differentiated (WDLS) and dedifferentiated liposarcomas (DDLS). Re-expression of miR-143 inhibited DDLS cell proliferation, induced apoptosis, and suppressed the expression of a module of genes including Bcl-2, topoisomerase 2A (TOP2A), polo-like kinase 1(PLK1), and protein regulator of cytokinesis 1 (PRC1) (Ugras et al., 2011).
Entity name
Breast cancer
Note
Reduced levels of miR-143 was demonstrated in different breast cancer cell lines and primary tumours. Restoration of the miR-143 expression in breast cancer cells was found to inhibit cell proliferation and the formation of soft agar colonies. DNA methyltransferase 3A (DNMT3A) was validated as a direct target of miR-143, which resulted in the regulation of phosphatase and tensin homolog (PTEN) and TNFRSF10C promoter methylation (Ng et al., 2013).
Entity name
Ulcerative oesophagitis
Note
Up-regulation of miR-143 expression was reported in the oesophageal mucosa of ulcerative oesophagitis patients. It was suggested to induce apoptosis, and regulate the cell proliferation of oesophageal epithelium in response to gastro-oesophageal reflux (Smith et al., 2013).
Entity name
Glucose Metabolism
Note
miR-143 was reported to inhibit glycolysis in a variety of cancer cells, including breast cancer, glioblastoma, colon cancer, head and neck squamous cell carcinoma, and lung cancer (Fang et al., 2012; Gregersen et al., 2012; Jiang et al., 2012; Peschiaroli et al., 2013; Zhao et al., 2013). Hexokinase 2 (HK2) was validated as a direct target of miR-143, in which their interaction was hypothesized to be an important regulator of glucose metabolism in cancer cells.
Entity name
MDM2-p53 pathway
Note
miR-143 and miR-145 were reported to negatively modulate MDM2 expression and were post-transcriptionally activated by tumour suppressor protein p53. Together, miR-143/145, MDM2 and p53 form a regulatory feedback loop that was shown to modulate cell proliferation and apoptosis in the head and neck squamous cell carcinomas (Zhang et al., 2013a).
Article Bibliography
| Pubmed ID | Last Year | Title | Authors |
|---|---|---|---|
| 22593586 | 2012 | MicroRNA-143 (miR-143) regulates cancer glycolysis via targeting hexokinase 2 gene. | Fang R et al |
| 22691140 | 2012 | MicroRNA-143 down-regulates Hexokinase 2 in colon cancer cells. | Gregersen LH et al |
| 23866094 | 2013 | The regulation of Toll-like receptor 2 by miR-143 suppresses the invasion and migration of a subset of human colorectal carcinoma cells. | Guo H et al |
| 22948942 | 2012 | miR-143 and miR-145 inhibit stem cell characteristics of PC-3 prostate cancer cells. | Huang S et al |
| 20525177 | 2010 | Identification of non-coding RNAs embracing microRNA-143/145 cluster. | Iio A et al |
| 23932921 | 2013 | DDX6 post-transcriptionally down-regulates miR-143/145 expression through host gene NCR143/145 in cancer cells. | Iio A et al |
| 22354042 | 2012 | A novel miR-155/miR-143 cascade controls glycolysis by regulating hexokinase 2 in breast cancer cells. | Jiang S et al |
| 22160209 | 2012 | miR-143 is downregulated in cervical cancer and promotes apoptosis and inhibits tumor formation by targeting Bcl-2. | Liu L et al |
| 24218337 | 2014 | MicroRNA-143 is downregulated in breast cancer and regulates DNA methyltransferases 3A in breast cancer cells. | Ng EK et al |
| 23276710 | 2013 | MicroRNA-143 functions as a tumor suppressor in human esophageal squamous cell carcinoma. | Ni Y et al |
| 23104321 | 2013 | Replacement treatment with microRNA-143 and -145 induces synergistic inhibition of the growth of human bladder cancer cells by regulating PI3K/Akt and MAPK signaling pathways. | Noguchi S et al |
| 22469988 | 2013 | miR-143 regulates hexokinase 2 expression in cancer cells. | Peschiaroli A et al |
| 23973710 | 2013 | miR-143 decreases COX-2 mRNA stability and expression in pancreatic cancer cells. | Pham H et al |
| 23574723 | 2013 | MicroRNA-143 inhibits tumor growth and angiogenesis and sensitizes chemosensitivity to oxaliplatin in colorectal cancers. | Qian X et al |
| 23297865 | 2013 | Impact of gastro-oesophageal reflux on microRNA expression, location and function. | Smith CM et al |
| 19626115 | 2009 | Modulation of microRNA processing by p53. | Suzuki HI et al |
| 21693658 | 2011 | Small RNA sequencing and functional characterization reveals MicroRNA-143 tumor suppressor activity in liposarcoma. | Ugras S et al |
| 22330136 | 2013 | Loss of microRNA-143/145 disturbs cellular growth and apoptosis of human epithelial cancers by impairing the MDM2-p53 feedback loop. | Zhang J et al |
| 24070896 | 2013 | Targeting PKCε by miR-143 regulates cell apoptosis in lung cancer. | Zhang N et al |
| 23376635 | 2013 | miR-143 inhibits glycolysis and depletes stemness of glioblastoma stem-like cells. | Zhao S et al |
Other Information
Locus ID:
NCBI: 406935
MIM: 612117
HGNC: 31530
Ensembl: ENSG00000284182
miRBase:
Variants:
dbSNP: 406935
ClinVar: 406935
TCGA: ENSG00000284182
COSMIC: MIR143
RNA/Proteins
Pathways
| Pathway | Source | External ID |
|---|---|---|
| MicroRNAs in cancer | KEGG | hsa05206 |
| MicroRNAs in cancer | KEGG | ko05206 |
References
| Pubmed ID | Year | Title | Citations |
|---|---|---|---|
| 37815745 | 2024 | MiR-143-3p/FNDC5 axis: a novel regulator of insulin sensitivity. | 0 |
| 37962045 | 2024 | Novel Circular RNA CircUBAP2 Drives Tumor Progression by Regulating the miR-143/TFAP2B Axis in Prostate Cancer. | 1 |
| 38117249 | 2024 | The Regulation of Fatty Acid Synthase by Exosomal miR-143-5p and miR-342-5p in Idiopathic Pulmonary Fibrosis. | 1 |
| 38412676 | 2024 | Hsa_circ_0036872 has an important promotional effect in enhancing osteogenesis of dental pulp stem cells by regulating the miR-143-3p/IGF2 axis. | 1 |
| 38457157 | 2024 | The association of microRNAs in the development of retinopathy of prematurity. | 0 |
| 38674017 | 2024 | Stable Dual miR-143 and miR-506 Upregulation Inhibits Proliferation and Cell Cycle Progression. | 0 |
| 38717032 | 2024 | MiR-143-3p regulates chondrogenic differentiation of synovium derived mesenchymal stem cells under mechanical stress through the BMPR2-Smad signalling pathway by targeting BMPR2. | 0 |
| 38824534 | 2024 | Long non-coding RNA MEG3 knockdown represses airway smooth muscle cells proliferation and migration via sponging miR-143-3p/FGF9 in asthma. | 0 |
| 38874783 | 2024 | Are micro-RNA 21 and 143 indicative as prognostic biomarkers in dedifferentiated endometrial adenocarcinoma? | 0 |
| 38994765 | 2024 | Biological functions and potential mechanisms of miR‑143‑3p in cancers (Review). | 0 |
| 37815745 | 2024 | MiR-143-3p/FNDC5 axis: a novel regulator of insulin sensitivity. | 0 |
| 37962045 | 2024 | Novel Circular RNA CircUBAP2 Drives Tumor Progression by Regulating the miR-143/TFAP2B Axis in Prostate Cancer. | 1 |
| 38117249 | 2024 | The Regulation of Fatty Acid Synthase by Exosomal miR-143-5p and miR-342-5p in Idiopathic Pulmonary Fibrosis. | 1 |
| 38412676 | 2024 | Hsa_circ_0036872 has an important promotional effect in enhancing osteogenesis of dental pulp stem cells by regulating the miR-143-3p/IGF2 axis. | 1 |
| 38457157 | 2024 | The association of microRNAs in the development of retinopathy of prematurity. | 0 |
Citation
Ava Kwong ; Vivian Y Shin ; John C W Ho
MIR143 (MicroRNA 143)
Atlas Genet Cytogenet Oncol Haematol. 2014-02-01
Online version: http://atlasgeneticsoncology.org/gene/50848/mir143-(microrna-143)
