MIR449A (microRNA 449a)

2012-10-01   Cristina Gallinas Suazo  , Muriel Lizé  

Department of Molecular Oncology - University of Goettingen, Goettingens Centre for Molecular Biosciences (GZMB), Ernst Caspari Haus, Justus-von-Liebig-Weg 11, D-37077 Goettingen, Germany

Identity

HGNC
LOCATION
5q11.2
IMAGE
Atlas Image
LEGEND
A) Alignment of the mature sequences of the miR-34/449 family members. Modified from Lizé et al., 2010. B) Genomic localization of miR-449 family on chromosome 5q11.2 (source: www.ncbi.nlm.nih.gov/gene/).
LOCUSID
ALIAS
MIRN449,MIRN449A,hsa-mir-449,mir-449a

DNA/RNA

Atlas Image
A) Stem-loop structure of miR-449a. B) Stem-loop structure of miR-449b. C) Stem-loop structure of miR-449c. The sequence of the mature microRNAs is colored in green. (source: www.mirbase.org/).

Description

The microRNA-449 family is a group of three small, non-coding RNAs first identified in embryonic mice (Mineno et al., 2006; Wheeler et al., 2006) and highly conserved in different species. The whole cluster consists of three members in human: miR-449a (MI0001648), miR-449b (MI0003673), and miR-449c (MI0003823), they are located in the second intron of the Cdc20b gene and they share its promoter.
Sequence miR-449a: uggcaguguauuguuagcuggu (22 bp)
Sequence miR-449b: aggcaguguauuguuagcuggc (22 bp)
Sequence miR-449c: uaggcaguguauugcuagcggcugu (25 bp)
They regulate gene expression post-transcriptionally by mRNA degradation or translational repression (Esquela-Kerscher and Slack, 2006).

Transcription

Transcription starts from chromosome 5: 54466360-54466450 [-] in human. E2F1 is a transcriptional activator of the locus (Yang et al., 2009; Lizé et al., 2010), IL-13 a repressor (Solberg et al., 2012).
The synthesis of miRNAs starts with the primary transcription by the RNA polymerase II (Lee et al., 2004) in the nucleus of a capped and polyadenylated precursor named pri-miRNA. The pri-miRNA of miR-449a is 91 base pairs long, the one of miR-449b is 97 bp in and pri-miR-449c is 92 bp in. The precursors are then further processed by the nucleases Drosha and Pasha, which are able to recognize and cut the stem-loop structure to generate the pre-miRNA. Finally, these pre-miRNAs are exported into the cytoplasm and are cleaved by the ribonuclease Dicer (Lund and Dahlberg, 2006) to get the mature 22-25 bp miR-449. The mature microRNA recognizes its target mostly via the "seed sequence", and when loaded into the RNA induced silencing complex (RISC), they lead to the degradation or the inhibition of the translation of the targeted mRNA (Hammond et al., 2000).

Expression
miR-449 expression is strongly induced during mucociliary differentiation (Lizé et al., 2010; Marcet et al., 2011). miR-449 is down-regulated in various cancers, most probably through epigenetic silencing (Yang et al., 2009; Noonan et al., 2009; Lizé et al., 2010; Noonan et al., 2010; Bou Kheir et al., 2011; Buurman et al., 2012; Chen et al., 2012). miR-449 is E2F1- and DNA damage responsive and negatively regulates the E2F pathway both through the direct targeting of E2F transcription factors and indirectly through the downregulation of cyclin-dependent kinases (CDKs) either directly or through the induction of the CDK-inhibitor p21 (Yang et al., 2009; Lizé et al., 2010). miR-449s promoter is repressed by Interleukin 13 (IL-13), leading to an increase in Notch expression and mucociliary differentiation alteration (Solberg et al., 2012). MiR-449 targets: cyclin dependent kinase 6 (CDK6), cell division cycle 25 homolog A (CDC25A); and histone deacetylase 1 (HDAC1), cyclin D1 (CCND1), cyclin E2 (CCNE2), SIRT1, Delta-like 1 (DLL1), E2F transcription factor 5 (E2F5), Geminin (GMNN), MET protooncogene (MET), v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived (N-myc), Drosophila notch homolog 1 (Notch1) (Bommer et al., 2007; Sun et al., 2008; Noonan et al., 2009; Redshaw et al., 2009; Yang et al., 2009; Lizé et al., 2010; Bou Kheir et al., 2011; Buechner et al., 2011; Lizé et al., 2011; Marcet et al., 2011).

Localisation
miR-449 is expressed at high levels in tissues containing ciliated cells, especially choroid plexus (Redshaw et al., 2009), lung, testis and trachea (Lizé et al., 2010; Marcet et al., 2011; Bao et al., 2012). It is expressed specifically in multiciliated cells (Marcet et al., 2011).

Function
miR-449 is a strong inducer of cell cycle arrest (including senescence) and apoptosis in tumor cell lines (Noonan et al., 2009; Yang et al., 2009; Lizé et al., 2010; Noonan et al., 2010; Bou Kheir et al., 2011). It is also involved in mucociliary differentiation (Lizé et al., 2010; Marcet et al., 2011).
miR-449 regulates several pathways (reviewed in Lizé et al., 2011) including Notch (Capuano et al., 2011; Marcet et al., 2011), p53 (Lizé et al., 2010), E2F-Rb (Redshaw et al., 2009; Yang et al., 2009; Lizé et al., 2010; Noonan et al., 2010; Bao et al., 2012), Wnt (Iliopoulos et al., 2009) and the cell cycle (Noonan et al., 2009; Yang et al., 2009; Lizé et al., 2010; Noonan et al., 2010; Bou Kheir et al., 2011).

Proteins

Note

MicroRNAs are not translated into proteins. See DNA for further description.

Implicated in

Entity name
Various cancers
Oncogenesis
MiR-449 functions as a tumor suppressor and is down-regulated in various cancer cells (Yang et al., 2009; Lizé et al., 2010; Ma and Tao, 2012) such as: lung adenocarcinoma and squamous cell carcinoma (Liang 2008), prostate cancer (Noonan et al., 2009), craniopharyngioma (Campanini et al., 2010), colon cancer cells (Wang et al., 2010), gastric cancer (Bou Kheir et al., 2011), hepatocellular carcinoma (Buurman et al., 2012), bladder cancer (Chen et al., 2012); while it is up-regulated in endometrioid adenocarcinoma (Wu et al., 2009).
Entity name
Lung cancer
Note
In silico studies reveal that miR-449 may be down-regulated in different kinds of lung cancer such as lung adenocarcinoma and squamous cell carcinoma (Liang, 2008). miR-449 is strongly down-regulated in the lung carcinoma cell line H1299 in comparison to normal lung tissue (Lizé et al., 2010).
Entity name
Prostate cancer
Note
In prostate cancer, miR-449 has a role in cell growth regulation by repressing the histone deacetylase 1 (HDAC-1) expression. The activation of HDAC1 by the loss of miR-449 in prostate cancer cells is critical for their epigenetic evolution (Noonan et al., 2009).
Entity name
Craniopharyngioma
Note
The down-regulation of miR-449 may have a role in the inhibition of the Wnt signaling pathway in craniopharyngioma (Campanini et al., 2010).
Entity name
Gastric cancer
Note
miR-449 is down-regulated or even absent in mouse models of gastric cancer and in primary human gastric tumors (Wang et al., 2010; Bou Kheir et al., 2011). Although the development of gastric cancer is primarily related to H. Pylori infection, levels of gastrin are also involved in gastric cancer. Studies of the miR-449b expression in Gastrin knockout mice and in mice infected by H. pylori showed that, in both cases, the miR-449b is down-regulated compared to the control mice. Moreover, ectopic expression of miR-449b in SNU638 cells affects their proliferation and leads to apoptosis and senescence.
Entity name
Hepatocellular carcinoma
Note
MiR-449 is down-regulated in hepatocellular carcinoma which results in high levels of histone deacetylases, leading to increased c-MET. C-Met is the receptor for hepatocyte growth factor in hepatocellular carcinoma cells (Buurman et al., 2012).
Entity name
Bladder cancer
Note
miR-449a is downregulated in bladder cancer cells as compared to normal tissue. Reintroduction of miR-449 in the bladder cancer cell lines T24 and 5537 lead rather to cell cycle arrest than to apoptosis. The inhibition of the tumor growth by using liposome encapsulated miR-449a in vivo was successful (Chen et al., 2012).
Entity name
Endometrioid adenocarcinoma
Note
MiR-449 is up-regulated in endometrioid adenocarcinoma cells. The expression of the estrogen receptor gene, entailed in this cancer type, could be regulated by miR-449 (Wu et al., 2009).
Entity name
Asthma
Note
A common feature of asthma is the alteration of the airway epithelial cells. The analyses of asthmatic bronchial epithelium showed that interleukin 13 (IL-13) contributes to miR-449 repression in asthma. This leads to an increase of the Notch expression, which results in the reduction of ciliated cell and increase of mucous cells (Solberg et al., 2012).
Entity name
Primary pigmented nodular adrenocortical disease
Note
miR-449 is up-regulated in primary pigmented nodular adrenocortical disease (PPNAD) (Iliopoulos et al., 2009).

Article Bibliography

Pubmed IDLast YearTitleAuthors
225704832012MicroRNA-449 and microRNA-34b/c function redundantly in murine testes by targeting E2F transcription factor-retinoblastoma protein (E2F-pRb) pathway.Bao J et al
176560952007p53-mediated activation of miRNA34 candidate tumor-suppressor genes.Bommer GT et al
214185582011miR-449 inhibits cell proliferation and is down-regulated in gastric cancer.Bou Kheir T et al
216546842011Tumour-suppressor microRNAs let-7 and mir-101 target the proto-oncogene MYCN and inhibit cell proliferation in MYCN-amplified neuroblastoma.Buechner J et al
226410682012Histone deacetylases activate hepatocyte growth factor signaling by repressing microRNA-449 in hepatocellular carcinoma cells.Buurman R et al
217613662010CTNNB1 gene mutations, pituitary transcription factors, and MicroRNA expression involvement in the pathogenesis of adamantinomatous craniopharyngiomas.Campanini ML et al
221949962011MicroRNA-449a overexpression, reduced NOTCH1 signals and scarce goblet cells characterize the small intestine of celiac patients.Capuano M et al
222661872012MicroRNA-449a acts as a tumor suppressor in human bladder cancer through the regulation of pocket proteins.Chen H et al
165572792006Oncomirs - microRNAs with a role in cancer.Esquela-Kerscher A et al
179916812008miRBase: tools for microRNA genomics.Griffiths-Jones S et al
107492132000An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells.Hammond SM et al
210714112011miRTarBase: a database curates experimentally validated microRNA-target interactions.Hsu SD et al
193518152009MicroRNA signature of primary pigmented nodular adrenocortical disease: clinical correlations and regulation of Wnt signaling.Iliopoulos D et al
210372582011miRBase: integrating microRNA annotation and deep-sequencing data.Kozomara A et al
153720722004MicroRNA genes are transcribed by RNA polymerase II.Lee Y et al
190873252008An expression meta-analysis of predicted microRNA targets identifies a diagnostic signature for lung cancer.Liang Y et al
210884932010MicroRNA-449a levels increase by several orders of magnitude during mucociliary differentiation of airway epithelia.Lizé M et al
218571592011MicroRNA-449 in cell fate determination.Lizé M et al
199600222010E2F1-inducible microRNA 449a/b suppresses cell proliferation and promotes apoptosis.Lizé M et al
173812812006Substrate selectivity of exportin 5 and Dicer in the biogenesis of microRNAs.Lund E et al
221685932012Microribonucleic acids and gastric cancer.Ma YY et al
216027952011Control of vertebrate multiciliogenesis by miR-449 through direct repression of the Delta/Notch pathway.Marcet B et al
165821022006The expression profile of microRNAs in mouse embryos.Mineno J et al
209489892010miR-449a causes Rb-dependent cell cycle arrest and senescence in prostate cancer cells.Noonan EJ et al
190563562009microRNA-449 is a putative regulator of choroid plexus development and function.Redshaw N et al
229553192012Airway epithelial miRNA expression is altered in asthma.Solberg OD et al
184063532008Downregulation of CCND1 and CDK6 by miR-34a induces cell cycle arrest.Sun F et al
221352972012TarBase 6.0: capturing the exponential growth of miRNA targets with experimental support.Vergoulis T et al
208597562010Differential miRNA expression and their target genes between NGX6-positive and negative colon cancer cells.Wang XY et al
165669242006Identification of new central nervous system specific mouse microRNAs.Wheeler G et al
190775652009Expression profile of mammalian microRNAs in endometrioid adenocarcinoma.Wu W et al
198337672009miR-449a and miR-449b are direct transcriptional targets of E2F1 and negatively regulate pRb-E2F1 activity through a feedback loop by targeting CDK6 and CDC25A.Yang X et al

Other Information

Locus ID:

NCBI: 554213
MIM: 613131
HGNC: 27645
Ensembl: ENSG00000198983
miRBase:

Variants:

dbSNP: 554213
ClinVar: 554213
TCGA: ENSG00000198983
COSMIC: MIR449A

RNA/Proteins

Pathways

PathwaySourceExternal ID
MicroRNAs in cancerKEGGhsa05206
MicroRNAs in cancerKEGGko05206

References

Pubmed IDYearTitleCitations
382150772024AGO2-RIP-Seq reveals miR-34/miR-449 cluster targetome in sinonasal cancers.0
382150772024AGO2-RIP-Seq reveals miR-34/miR-449 cluster targetome in sinonasal cancers.0
366956932023miR-449a ameliorates acute rejection after liver transplantation via targeting procollagen-lysine1,2-oxoglutarate5-dioxygenase 1 in macrophages.1
366956932023miR-449a ameliorates acute rejection after liver transplantation via targeting procollagen-lysine1,2-oxoglutarate5-dioxygenase 1 in macrophages.1
346476532022MiRNome analysis identifying miR-205 and miR-449a as biomarkers of disease progression in intestinal-type sinonasal adenocarcinoma.5
351528392022Circular RNA CDK6 suppresses cervical cancer proliferation and metastasis by sponging miR-449a.2
352126072022Silencing of long chain noncoding RNA paternally expressed gene (PEG10) inhibits the progression of neuroblastoma by regulating microRNA-449a (miR-449a)/ribosomal protein S2 (RPS2) axis.1
355635222022MicroRNA-449a Inhibits Triple Negative Breast Cancer by Disturbing DNA Repair and Chromatid Separation.0
362061022022Exosome-mediated transfer of circ_0063526 enhances cisplatin resistance in gastric cancer cells via regulating miR-449a/SHMT2 axis.7
346476532022MiRNome analysis identifying miR-205 and miR-449a as biomarkers of disease progression in intestinal-type sinonasal adenocarcinoma.5
351528392022Circular RNA CDK6 suppresses cervical cancer proliferation and metastasis by sponging miR-449a.2
352126072022Silencing of long chain noncoding RNA paternally expressed gene (PEG10) inhibits the progression of neuroblastoma by regulating microRNA-449a (miR-449a)/ribosomal protein S2 (RPS2) axis.1
355635222022MicroRNA-449a Inhibits Triple Negative Breast Cancer by Disturbing DNA Repair and Chromatid Separation.0
362061022022Exosome-mediated transfer of circ_0063526 enhances cisplatin resistance in gastric cancer cells via regulating miR-449a/SHMT2 axis.7
333901862021CDK13 upregulation-induced formation of the positive feedback loop among circCDK13, miR-212-5p/miR-449a and E2F5 contributes to prostate carcinogenesis.24

Citation

Cristina Gallinas Suazo ; Muriel Lizé

MIR449A (microRNA 449a)

Atlas Genet Cytogenet Oncol Haematol. 2012-10-01

Online version: http://atlasgeneticsoncology.org/gene/50881/mir449a-(microrna-449a)