Molecular Biology Unit, Department of Experimental Medicine, Biotechnology, Post Graduate Institute of Medical Education, Research, Chandigarh, India
Pre-miRNA The primary transcripts of microRNAs are processed by enzymatic microprocessor Drosha (RNase III enzyme) and DGCR8 (dsRNA binding protein) from their 3 and 5 cleavage sites into an intermediate stem-loop precursor or pre-miRNA in the nucleus. The precursor of miR-196b is 84 bases long (pre-miR-196b), forms a secondary structure, and contains the mature miRNA sequence, stem and terminal loop structures with 2-nt 3 overhang. The precursor is then transferred from nucleus to cytoplasm by the enzyme exportin 5. In cytoplasm, a second RNase III enzyme, Dicer, removes terminal loop generating about 20-bp RNA duplex.
Length: 84 bases.
Sequence: ACUGGUCGGUGAUUUAGGUAGUUUCCUGUUGUUGGGA UCCACCUUUCUCUCGACAGCACGACACUGCCUUCAUUA CUUCAGUUG
Mature miR-196b The mature miRNA forms one strand of the RNA duplex. One strand is degraded and other is incorporated in to a protein complex, RNA induced silencing complex (RISC), targeting a partially complementary target mRNA. miR-196b is 22 nucleotide long.
Sequence: UAGGUAGUUUCCUGUUGUUGGG
HOXB8: target of miR-196b HOXB8 mRNA was shown to be a natural target for miR-196b-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression.
NCBI: 442920 MIM: 609688 HGNC: 31790 Ensembl: ENSG00000283745 miRBase:
dbSNP: 442920 ClinVar: 442920 TCGA: ENSG00000283745 COSMIC: MIR196B
Deepak Kaul ; Deepti Malik
MIR196B (microRNA 196b)
Atlas Genet Cytogenet Oncol Haematol. 2011-12-01
Online version: http://atlasgeneticsoncology.org/gene/51736/css/lib/bootstrap.min.css