MIR196B (microRNA 196b)

2011-12-01   Deepak Kaul  , Deepti Malik  

Molecular Biology Unit, Department of Experimental Medicine, Biotechnology, Post Graduate Institute of Medical Education, Research, Chandigarh, India

Identity

HGNC
LOCATION
7p15.2
IMAGE
Atlas Image
LEGEND
Figure 1. Stem-loop structure of miR-196b.
LOCUSID
ALIAS
MIRN196B,miR-196b,miRNA196B

DNA/RNA

Atlas Image
Figure 2. A. hsA-miR-196 (chromosome 7). B. HOXB8: target of miR-196b.

Description

miR-196 is non-coding vertebrate specific micro-RNA (MI0000238, MI0000279) and has been experimentally confirmed in a wide range of vertebrate species (MIPF0000031). miR-196b is expressed from intergenic regions in HOX gene clusters that are the targets of miR-196b.
The hairpin precursors are predicted based on base pairing and cross-species conservation - their extents are not known. In this case the mature sequence is excised from the 5 arm of the hairpin.
Three miR-196 genes have been found. The miR-196a-1 gene is located on chromosome 17 (17q21.32) at a site between HOXB9 and HOXB10 genes, and the miR-196a-2 gene is located at a region between HOXC10 and HOXC9 on chromosome 12 (12q13.13). The gene for miR-196b is located in a highly evolutionarily conserved region between HOXA9 and HOXA10 genes, on chromosome 7 (7p15.2) in human beings. miR-196a-1 and miR-196a-2 genes transcribe the same functional mature miRNA sequence (3-GGGUUGUUGUACUUUGAUGGAU-5), whereas miR-196b gene produces a small RNA (3-GGGUUGUUGUCCUUUGAUGGAU-5), which differs from the sequence of miR-196a by one nucleotide.

Pre-miRNA
The primary transcripts of microRNAs are processed by enzymatic microprocessor Drosha (RNase III enzyme) and DGCR8 (dsRNA binding protein) from their 3 and 5 cleavage sites into an intermediate stem-loop precursor or pre-miRNA in the nucleus. The precursor of miR-196b is 84 bases long (pre-miR-196b), forms a secondary structure, and contains the mature miRNA sequence, stem and terminal loop structures with 2-nt 3 overhang. The precursor is then transferred from nucleus to cytoplasm by the enzyme exportin 5. In cytoplasm, a second RNase III enzyme, Dicer, removes terminal loop generating about 20-bp RNA duplex.

Length: 84 bases.

Sequence:
ACUGGUCGGUGAUUUAGGUAGUUUCCUGUUGUUGGGA
UCCACCUUUCUCUCGACAGCACGACACUGCCUUCAUUA
CUUCAGUUG

Mature miR-196b
The mature miRNA forms one strand of the RNA duplex. One strand is degraded and other is incorporated in to a protein complex, RNA induced silencing complex (RISC), targeting a partially complementary target mRNA. miR-196b is 22 nucleotide long.

Sequence:
UAGGUAGUUUCCUGUUGUUGGG

HOXB8: target of miR-196b
HOXB8 mRNA was shown to be a natural target for miR-196b-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression.

Implicated in

Entity name
Leukemia
Note
Significant down-regulation of miR-196b for the first time was reported in EB-3, MOLT-4 cell lines as well as in B and T-cell ALL patients as compared to their corresponding controls. miR-196b restoration in EB-3 cells leads to significant down-regulation of c-myc (over-amplified in B and T-cell ALL patients) and its effector genes i.e., human telomerase reverse transcriptase (hTERT), B-cell lymphoma/leukemia-2 (Bcl-2), apoptosis antagonizing transcription factor (AATF), confirming miR-196b functions as tumor suppressor miRNA in B-cell ALL (acute lymphoblastic leukemia) however, transfection experiments in MOLT-4 cell line revealed that miR-196b is not able to knock down the expression of c-myc gene as it was found that miR-196b loses its ability to down-regulate c-myc gene expression in T-cell ALL as a consequence of mutations in target 3-untranslated region (3-UTR) of the c-myc gene.
Expression of miR-196a and miR-196b is higher in AML patients with NPM1 gene (nucleophosmin) mutations as compared to NPM1-wildtype. In T-ALL patients, miR-196a and miR-196b expression was associated with an immature immunophenotype, and expression of CD34 and CD33. Hence, these miRNAs were identified as ERG regulators and implicate a potential role in acute leukemia.
Comparison of AML patients with normal karyotype (NK-AML) showed down-regulation of miR-196b in AML patients with abnormal karyotypes.
Within the hematopoietic lineage, miR-196b is most abundant in short-term hematopoietic stem cells and is down-regulated in more differentiated hematopoietic cells. Analysis of 55 primary leukemia samples reported over-expression of miR-196b specifically in patients with MLL associated leukemias and its enhanced expression in bone marrow progenitor cells leads to increased proliferative capacity and survival as well as partial block in differentiation. This suggests a mechanism that how increased expression of miR-196b by MLL fusion proteins significantly contributes to leukemia development.
Another report suggests that expression of miR-196b is not exclusively MLL-driven but is linked to activation of HOXA genes in pediatric acute lymphoblastic leukemia and its over-expression is not unique to MLL-rearranged acute lymphoblastic leukemia but also occurs in patients with T-cell acute lymphoblastic leukemia patients carrying CALM-AF10, SET-NUP214 and inversion of chromosome 7. Like MLL-rearrangements, these abnormalities are functionally linked with up-regulation of HOXA. In correspondence, miR-196b expression in these patients correlated strongly with the levels of HOXA family genes (Spearmans correlation coefficient ≥ 0,7; P≤ 0,005). Since miR-196b is encoded on the HOXA cluster, these data suggest co-activation of both miR-196b and HOXA genes in acute lymphoblastic leukemia. Up-regulation of miR-196b coincides with reduced DNA methylation at CpG islands in the promoter regions of miR-196b and the entire HOXA cluster in MLL-rearranged cases compared to the cases of non-MLL precursor B-cell acute lymphoblastic leukemia and normal bone marrow (P< 0,05), suggesting an epigenetic origin for miR-196b over-expression. miR-196b possess an oncogenic activity in bone marrow progenitor cells, these findings imply a potential role for miR-196b in the underlying biology of all HOXA-activated leukemias.
Entity name
Gastric cancer
Note
Hypomethylation status of miR-196b CpG islands and overexpression of this miRNA was observed in primary gastric tumors providing a link that DNA hypomethylation induces overexpression of miR-196b in gastric cancer.
Entity name
Glioblastoma
Note
Expression profiles in glioblastomas and anaplastic astrocytomas suggested that miR-196a and miR-196b showed increased expression levels in glioblastomas relative to both anaplastic astrocytomas and normal brains. miR-196a showed the most significant difference (P= 0,0038), with miR-196b also having a high significance (P= 0,0371). Furthermore, patients with high miR-196 expression levels showed significantly poorer survival by the Kaplan-Meier method (P= 0,0073). Analysis of expression of miR-196b in a group of 38 patients with primary glioblastoma multiforme (GBM) showed that miR-196b (P= 0,0492; log-rank test) positively correlated with overall survival further confirming that miR-196 may play a role in the malignant progression of gliomas and may be a prognostic predictor in glioblastomas.
Entity name
Breast cancer
Note
miR-196s function as potent metastasis suppressors and the ratio of miR-196s to HOXC8 mRNA might be an indicator of the metastatic capability of breast tumors. Transfection studies in metastatic MDA-MB-231 breast cancer cells identified members of the miRNA-196 family (miR-196a1, miR-196a2, and miR-196b) suppresses in vitro invasion and in vivo spontaneous metastasis of breast cancer cells. Further evidence providing the association between miR-196b and the transcription factor HOXC8 was that miR-196 inhibits the expression of HOXC8. Functional linkage was implied by small interfering RNA-mediated knockdown of HOXC8, which suppressed cell migration and metastasis, and by ectopic expression of HOXC8, which prevented the effects of miR-196 on cell migration and metastasis.
RNAs from 25 breast cancer tumors (8 metastatic tumor specimens and 17 metastasis-free tumor samples) and 4 normal breast tissues were analyzed by using qRT-PCR, which showed that the levels of HOXC8 mRNA or miR-196s (miR-196a and miR-196b together) were not correlated with the metastatic status of these samples instead, the ratio of miR-196s to HOXC8 mRNA was significantly lower in metastatic tissues than that of metastasis-free specimens or normal breast tissues.
These results suggest that the ratio of miR-196s to HOXC8 mRNA may be specifically correlated with the metastasis status of breast tumors.
Entity name
Pancreatic cancer
Note
Reports in the literature reveal that miR-196a and miR-196b levels were significantly increased in pancreatic ductal adenocarcinoma (PDAC) compared with normal tissue, as well as normal pancreatic lines and acute pancreatitis specimens.
Entity name
Myelopoiesis
Note
Gfi1 is a master regulator of miR expression in hematopoietic cells and it directly regulates miR-21 and miR196b during myelopoiesis. Deregulation of their expression distorts myelopoiesis. The miR-196b expression specifically and significantly controls granulocytic colony numbers and significantly (but not completely) blocks G-CSF-stimulated granulopoiesis, acting as a negative regulator of granulocytic differentiation. Recently, it has been shown that PRDM5 transcription factor regulates miR-21 and miR-196b through its interaction with Gfi1. GFI1 function is required for normal expression of miR-21 and miR-196b in healthy individuals and Gfi1 loss of function (GFI1N382S (mutant) SCN patient) and the higher steady-state levels of miR-21 and miR-196b overexpression propagate the dominant-negative effect of the GFI1N382S protein and disrupts granulocytic differentiation.

Article Bibliography

Pubmed IDLast YearTitleAuthors
209246502011Functional genomics of tumor suppressor miR-196b in T-cell acute lymphoblastic leukemia.Bhatia S et al
210916342011MicroRNA-196: critical roles and clinical applications in development and cancer.Chen C et al
205703492011The role of microRNA-196a and microRNA-196b as ERG regulators in acute myeloid leukemia and acute T-lymphoblastic leukemia.Coskun E et al
176360192007Epigenetic regulation of protein-coding and microRNA genes by the Gfi1-interacting tumor suppressor PRDM5.Duan Z et al
206014422010MiRNA-196 is upregulated in glioblastoma but not in anaplastic astrocytoma and has prognostic significance.Guan Y et al
207363652010Ratio of miR-196s to HOXC8 messenger RNA correlates with breast cancer cell migration and metastasis.Li Y et al
198341182009MicroRNAs: tools for cancer diagnostics.Paranjape T et al
191886692009Regulation of mir-196b by MLL and its overexpression by MLL fusions contributes to immortalization.Popovic R et al
204949362010Expression of miR-196b is not exclusively MLL-driven but is especially linked to activation of HOXA genes in pediatric acute lymphoblastic leukemia.Schotte D et al
206620762010Epigenetic regulation of miR-196b expression in gastric cancer.Tsai KW et al
192789562009Gfi1 regulates miR-21 and miR-196b to control myelopoiesis.Velu CS et al

Other Information

Locus ID:

NCBI: 442920
MIM: 609688
HGNC: 31790
Ensembl: ENSG00000283745
miRBase:

Variants:

dbSNP: 442920
ClinVar: 442920
TCGA: ENSG00000283745
COSMIC: MIR196B

RNA/Proteins

References

Pubmed IDYearTitleCitations
380397412024Upregulation of miRNA-196a and miRNA-196b correlates with Bryne's prognostic score in oral squamous cell carcinoma.0
383250462024miR-196b-5p regulates inflammatory process and migration via targeting Nras in trabecular meshwork cells.0
380397412024Upregulation of miRNA-196a and miRNA-196b correlates with Bryne's prognostic score in oral squamous cell carcinoma.0
383250462024miR-196b-5p regulates inflammatory process and migration via targeting Nras in trabecular meshwork cells.0
363480202023METTL3 promotes colorectal cancer metastasis by promoting the maturation of pri-microRNA-196b.6
365345022023Endothelial miR-196b-5p regulates angiogenesis via the hypoxia/miR-196b-5p/HMGA2/HIF1α loop.2
366411362023Long noncoding RNA FGD5-AS1 alleviates childhood IgA nephropathy by targeting PTEN-mediated JNK/c-Jun signaling pathway via miR-196b-5p.1
369080252023Circ_0078607 increases platinum drug sensitivity via miR-196b-5p/GAS7 axis in ovarian cancer.3
363480202023METTL3 promotes colorectal cancer metastasis by promoting the maturation of pri-microRNA-196b.6
365345022023Endothelial miR-196b-5p regulates angiogenesis via the hypoxia/miR-196b-5p/HMGA2/HIF1α loop.2
366411362023Long noncoding RNA FGD5-AS1 alleviates childhood IgA nephropathy by targeting PTEN-mediated JNK/c-Jun signaling pathway via miR-196b-5p.1
369080252023Circ_0078607 increases platinum drug sensitivity via miR-196b-5p/GAS7 axis in ovarian cancer.3
325129762022MicroRNA-196b promotes cell growth and metastasis of ovarian cancer by targeting ZMYND11.1
349748062022Long non-coding RNA H19 aggravates keloid progression by upregulating SMAD family member 5 expression via miR-196b-5p.1
352653052022Effect and Role of miR-196b in Ectopic Pregnancy.1

Citation

Deepak Kaul ; Deepti Malik

MIR196B (microRNA 196b)

Atlas Genet Cytogenet Oncol Haematol. 2011-12-01

Online version: http://atlasgeneticsoncology.org/gene/51736/chromosome-explorer/tumors-explorer/hgnc