MIR196B (microRNA 196b)
2011-12-01 Deepak Kaul  , Deepti Malik   AffiliationMolecular Biology Unit, Department of Experimental Medicine, Biotechnology, Post Graduate Institute of Medical Education, Research, Chandigarh, India
Identity

DNA/RNA

Description
The hairpin precursors are predicted based on base pairing and cross-species conservation - their extents are not known. In this case the mature sequence is excised from the 5 arm of the hairpin.
Three miR-196 genes have been found. The miR-196a-1 gene is located on chromosome 17 (17q21.32) at a site between HOXB9 and HOXB10 genes, and the miR-196a-2 gene is located at a region between HOXC10 and HOXC9 on chromosome 12 (12q13.13). The gene for miR-196b is located in a highly evolutionarily conserved region between HOXA9 and HOXA10 genes, on chromosome 7 (7p15.2) in human beings. miR-196a-1 and miR-196a-2 genes transcribe the same functional mature miRNA sequence (3-GGGUUGUUGUACUUUGAUGGAU-5), whereas miR-196b gene produces a small RNA (3-GGGUUGUUGUCCUUUGAUGGAU-5), which differs from the sequence of miR-196a by one nucleotide.
Pre-miRNA
The primary transcripts of microRNAs are processed by enzymatic microprocessor Drosha (RNase III enzyme) and DGCR8 (dsRNA binding protein) from their 3 and 5 cleavage sites into an intermediate stem-loop precursor or pre-miRNA in the nucleus. The precursor of miR-196b is 84 bases long (pre-miR-196b), forms a secondary structure, and contains the mature miRNA sequence, stem and terminal loop structures with 2-nt 3 overhang. The precursor is then transferred from nucleus to cytoplasm by the enzyme exportin 5. In cytoplasm, a second RNase III enzyme, Dicer, removes terminal loop generating about 20-bp RNA duplex.
Length: 84 bases.
Sequence:
ACUGGUCGGUGAUUUAGGUAGUUUCCUGUUGUUGGGA
UCCACCUUUCUCUCGACAGCACGACACUGCCUUCAUUA
CUUCAGUUG
Mature miR-196b
The mature miRNA forms one strand of the RNA duplex. One strand is degraded and other is incorporated in to a protein complex, RNA induced silencing complex (RISC), targeting a partially complementary target mRNA. miR-196b is 22 nucleotide long.
Sequence:
UAGGUAGUUUCCUGUUGUUGGG
HOXB8: target of miR-196b
HOXB8 mRNA was shown to be a natural target for miR-196b-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression.
Implicated in
Expression of miR-196a and miR-196b is higher in AML patients with NPM1 gene (nucleophosmin) mutations as compared to NPM1-wildtype. In T-ALL patients, miR-196a and miR-196b expression was associated with an immature immunophenotype, and expression of CD34 and CD33. Hence, these miRNAs were identified as ERG regulators and implicate a potential role in acute leukemia.
Comparison of AML patients with normal karyotype (NK-AML) showed down-regulation of miR-196b in AML patients with abnormal karyotypes.
Within the hematopoietic lineage, miR-196b is most abundant in short-term hematopoietic stem cells and is down-regulated in more differentiated hematopoietic cells. Analysis of 55 primary leukemia samples reported over-expression of miR-196b specifically in patients with MLL associated leukemias and its enhanced expression in bone marrow progenitor cells leads to increased proliferative capacity and survival as well as partial block in differentiation. This suggests a mechanism that how increased expression of miR-196b by MLL fusion proteins significantly contributes to leukemia development.
Another report suggests that expression of miR-196b is not exclusively MLL-driven but is linked to activation of HOXA genes in pediatric acute lymphoblastic leukemia and its over-expression is not unique to MLL-rearranged acute lymphoblastic leukemia but also occurs in patients with T-cell acute lymphoblastic leukemia patients carrying CALM-AF10, SET-NUP214 and inversion of chromosome 7. Like MLL-rearrangements, these abnormalities are functionally linked with up-regulation of HOXA. In correspondence, miR-196b expression in these patients correlated strongly with the levels of HOXA family genes (Spearmans correlation coefficient ≥ 0,7; P≤ 0,005). Since miR-196b is encoded on the HOXA cluster, these data suggest co-activation of both miR-196b and HOXA genes in acute lymphoblastic leukemia. Up-regulation of miR-196b coincides with reduced DNA methylation at CpG islands in the promoter regions of miR-196b and the entire HOXA cluster in MLL-rearranged cases compared to the cases of non-MLL precursor B-cell acute lymphoblastic leukemia and normal bone marrow (P< 0,05), suggesting an epigenetic origin for miR-196b over-expression. miR-196b possess an oncogenic activity in bone marrow progenitor cells, these findings imply a potential role for miR-196b in the underlying biology of all HOXA-activated leukemias.
RNAs from 25 breast cancer tumors (8 metastatic tumor specimens and 17 metastasis-free tumor samples) and 4 normal breast tissues were analyzed by using qRT-PCR, which showed that the levels of HOXC8 mRNA or miR-196s (miR-196a and miR-196b together) were not correlated with the metastatic status of these samples instead, the ratio of miR-196s to HOXC8 mRNA was significantly lower in metastatic tissues than that of metastasis-free specimens or normal breast tissues.
These results suggest that the ratio of miR-196s to HOXC8 mRNA may be specifically correlated with the metastasis status of breast tumors.
Article Bibliography
| Pubmed ID | Last Year | Title | Authors |
|---|---|---|---|
| 20924650 | 2011 | Functional genomics of tumor suppressor miR-196b in T-cell acute lymphoblastic leukemia. | Bhatia S et al |
| 21091634 | 2011 | MicroRNA-196: critical roles and clinical applications in development and cancer. | Chen C et al |
| 20570349 | 2011 | The role of microRNA-196a and microRNA-196b as ERG regulators in acute myeloid leukemia and acute T-lymphoblastic leukemia. | Coskun E et al |
| 17636019 | 2007 | Epigenetic regulation of protein-coding and microRNA genes by the Gfi1-interacting tumor suppressor PRDM5. | Duan Z et al |
| 20601442 | 2010 | MiRNA-196 is upregulated in glioblastoma but not in anaplastic astrocytoma and has prognostic significance. | Guan Y et al |
| 20736365 | 2010 | Ratio of miR-196s to HOXC8 messenger RNA correlates with breast cancer cell migration and metastasis. | Li Y et al |
| 19834118 | 2009 | MicroRNAs: tools for cancer diagnostics. | Paranjape T et al |
| 19188669 | 2009 | Regulation of mir-196b by MLL and its overexpression by MLL fusions contributes to immortalization. | Popovic R et al |
| 20494936 | 2010 | Expression of miR-196b is not exclusively MLL-driven but is especially linked to activation of HOXA genes in pediatric acute lymphoblastic leukemia. | Schotte D et al |
| 20662076 | 2010 | Epigenetic regulation of miR-196b expression in gastric cancer. | Tsai KW et al |
| 19278956 | 2009 | Gfi1 regulates miR-21 and miR-196b to control myelopoiesis. | Velu CS et al |
Other Information
Locus ID:
NCBI: 442920
MIM: 609688
HGNC: 31790
Ensembl: ENSG00000283745
miRBase:
Variants:
dbSNP: 442920
ClinVar: 442920
TCGA: ENSG00000283745
COSMIC: MIR196B
RNA/Proteins
References
| Pubmed ID | Year | Title | Citations |
|---|---|---|---|
| 38039741 | 2024 | Upregulation of miRNA-196a and miRNA-196b correlates with Bryne's prognostic score in oral squamous cell carcinoma. | 0 |
| 38325046 | 2024 | miR-196b-5p regulates inflammatory process and migration via targeting Nras in trabecular meshwork cells. | 0 |
| 38039741 | 2024 | Upregulation of miRNA-196a and miRNA-196b correlates with Bryne's prognostic score in oral squamous cell carcinoma. | 0 |
| 38325046 | 2024 | miR-196b-5p regulates inflammatory process and migration via targeting Nras in trabecular meshwork cells. | 0 |
| 36348020 | 2023 | METTL3 promotes colorectal cancer metastasis by promoting the maturation of pri-microRNA-196b. | 6 |
| 36534502 | 2023 | Endothelial miR-196b-5p regulates angiogenesis via the hypoxia/miR-196b-5p/HMGA2/HIF1α loop. | 2 |
| 36641136 | 2023 | Long noncoding RNA FGD5-AS1 alleviates childhood IgA nephropathy by targeting PTEN-mediated JNK/c-Jun signaling pathway via miR-196b-5p. | 1 |
| 36908025 | 2023 | Circ_0078607 increases platinum drug sensitivity via miR-196b-5p/GAS7 axis in ovarian cancer. | 3 |
| 36348020 | 2023 | METTL3 promotes colorectal cancer metastasis by promoting the maturation of pri-microRNA-196b. | 6 |
| 36534502 | 2023 | Endothelial miR-196b-5p regulates angiogenesis via the hypoxia/miR-196b-5p/HMGA2/HIF1α loop. | 2 |
| 36641136 | 2023 | Long noncoding RNA FGD5-AS1 alleviates childhood IgA nephropathy by targeting PTEN-mediated JNK/c-Jun signaling pathway via miR-196b-5p. | 1 |
| 36908025 | 2023 | Circ_0078607 increases platinum drug sensitivity via miR-196b-5p/GAS7 axis in ovarian cancer. | 3 |
| 32512976 | 2022 | MicroRNA-196b promotes cell growth and metastasis of ovarian cancer by targeting ZMYND11. | 1 |
| 34974806 | 2022 | Long non-coding RNA H19 aggravates keloid progression by upregulating SMAD family member 5 expression via miR-196b-5p. | 1 |
| 35265305 | 2022 | Effect and Role of miR-196b in Ectopic Pregnancy. | 1 |
Citation
Deepak Kaul ; Deepti Malik
MIR196B (microRNA 196b)
Atlas Genet Cytogenet Oncol Haematol. 2011-12-01
Online version: http://atlasgeneticsoncology.org/gene/51736/chromosome-explorer/tumors-explorer/hgnc
